WormMine: Gene WBGene00001005

• WormBase Gene ID: WBGene00001005
• Gene Name: dlc-1
• Sequence Name: T26A5.9
• Brief Description: dlc-1 encodes a dynein light chain 1, required for viability, that inhibits DHC-1 in vivo; DLC-1 is 92-95% identical to its orthologs human DYNLL1 (OMIM:601562) and DYNLL2 (OMIM:608942); DLC-1 is paralogous to DLC-2/-6; DLC-1 is expressed in adult body wall muscle, and in larval and adult pharynx, posterior intestine, and nervous system (e.g., ventral nerve cord, head neurons, and tail neurons); dlc-1 is probably transcriptionally activated by DAF-19; DLC-1 is required for normal embryonic and larval viability, embryonic pronuclear migration, growth speed, fertility, brood size, body shape, and cuticular integrity; anterograde movements of DLC-1 in neurons are regulated by PTL-1/Tau.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable dynein intermediate chain binding activity. Predicted to be involved in several processes, including apoptotic process; cell division; and meiotic cell cycle. Predicted to be located in cytoplasm; microtubule; and nuclear envelope. Predicted to be part of cytoplasmic dynein complex. Expressed in several structures, including germ cell; germ line; rectal valve cell; somatic cell; and ventral nerve cord. Is an ortholog of human DYNLL2 (dynein light chain LC8-type 2).
• Biotype: SO:0001217
• Genetic Position: III :-1.25437 ±0.00201
• Length (nt): 817

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001005

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T26A5.9.1	T26A5.9.1	537	III: 6462963-6463779

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T26A5.9	T26A5.9	270	III: 6463215-6463392

62 RNAi Result

• WBRNAi00082366
• WBRNAi00102950
• WBRNAi00082367
• WBRNAi00082902
• WBRNAi00026405
• WBRNAi00009223
• WBRNAi00054172
• WBRNAi00054173
• WBRNAi00113402
• WBRNAi00113610
• WBRNAi00090790
• WBRNAi00082368
• WBRNAi00091219
• WBRNAi00091218
• WBRNAi00071889
• WBRNAi00005767
• WBRNAi00005816
• WBRNAi00006767
• WBRNAi00087686
• WBRNAi00071292
• WBRNAi00102961
• WBRNAi00054174
• WBRNAi00054170
• WBRNAi00060088
• WBRNAi00060089
• WBRNAi00033400
• WBRNAi00002531
• WBRNAi00002730
• WBRNAi00114589
• WBRNAi00106656

10 Allele

• gk964518
• gk176648
• gk964032
• gk964033
• gk847728
• gk385460
• tm3153
• gk510190
• gk714220
• gk778010

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001005
• Start: 6462963
• End: 6463779
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_6462857..6462962
• Length (nt): 106
• Chromosome Location: III: 6462857-6462962
• Organism: Caenorhabditis elegans

164 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in N2 after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_N2
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated
Pheromone	Pheromone-induced transcripts that showed significantly decreased expression in post dauer animals comparing to wild type control.	edgeR	WBPaper00053713:Pheromone-induced_postdauer_vs_control_downregulated
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_downregulated
	Transcripts that were regulated by both set-6(ok2195) and baz-2(tm0235) at 2-day post L4 adult hermaphrodite stage.	N.A.	WBPaper00059356:set-6(ok2195)_baz-2(tm0235)_regulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed

17 Expression Patterns

• Primary Identifier: Expr1030626
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6777
• Remark: Also expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated. Strain: BC12911
• Reporter Gene: [dlc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACTTTGTGATCGTCGGATTTA] 3' and primer B 5' [ATTTTGAACGGATTTGGCTG] 3'.
• Pattern: Adult Expression: pharynx; Nervous System; head neurons; neurons along body; unidentified cells in tail ; Larval Expression: pharynx; body wall muscle; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr6776
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10571
• Reporter Gene: [dlc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACTTTGTGATCGTCGGATTTA] 3' and primer B 5' [ATTTTGAACGGATTTGGCTG] 3'.
• Pattern: Adult Expression: pharynx; intestine - posterior cells; Nervous System; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine - posterior cells; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr11603
• Pattern: A transcriptional dlc-1::gfp construct is expressed in many different types of cells, including pharynx, intestine, and body wall muscles. Expression was also observed in the ventral nerve cord.

• Primary Identifier: Expr11251
• Pattern: DLC-1 was expressed in numerous tissues including the intestine, body wall muscles, germ cells and oocytes, the rectal valve cell and unidentified cells in the head. DLC-1 was expressed at all developmental stages from the one-cell embryo.

• Primary Identifier: Expr14893
• Pattern: Pdlc-1::dlc-1::GFP was expressed in the intestine, muscle, hypodermis, and the rectal valve cells, and unidentified cells in the head.

• Primary Identifier: Expr16057
• Pattern: 3xFLAG-tagged DLC-1 was expressed throughout the germline, from the distal stem cells and progenitors to the oocytes, consistent with the previously reported endogenous expression pattern.

• Primary Identifier: Expr13422
• Subcellular Localization: DLC-1 showed a broad diffuse distribution across the germline, overlapping with DHC-1, but without detectable enrichment at the sites of DHC-1 accumulation. FLAG::DLC-1 is present within P granules in both the mitotic region and the transition zone. DLC-1 was not particularly enriched in P granules compared with overall cytoplasmic background. Additionally, we observed foci of DLC-1 that did not coincide with either P granules or DHC-1 patches. As DLC-1 overlaps with both P granules and DHC-1 patches, we conclude that DLC-1 might support function of both protein complexes.

• Primary Identifier: Expr2010941
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr13344
• Subcellular Localization: As expected from a non-motor subunit, DLC-1::GFP showed more diffuse staining than GFP::DHC-1 (Expr13343) but was still enriched at the dendrite tip in 85% of the animals. Axon tip enrichment was also frequently observed, consistent with reports from mammalian neurons.

• Primary Identifier: Expr12316
• Subcellular Localization: DLC-1 is distributed along the cilia in ciliated neurons.

• Primary Identifier: Expr14894
• Subcellular Localization: DHC-1::GFP was co-localized with DHS-3::mCherry-labeled lipid droplets in the wild type.

• Primary Identifier: Expr1157717
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr14490
• Subcellular Localization: DLC-1::GFP fluorescence was enriched as puncta at the spindle pole where centrioles localize during Q cell division. After Q cell division and migration, one of the two GFP puncta entered the growing dendrite and underwent the directional movement toward the dendritic tip as the motile centriole at the velocity of 0.11 0.03 lm/min

• Primary Identifier: Expr16056
• Pattern: 3xFLAG::DLC-1 is also abundant in somatic tissues.

• Primary Identifier: Expr2029180
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1022333
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

24 GO Annotation

13 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001005
• Start: 6462963
• End: 6463779
• Strand: -1

24 Ontology Annotations

1 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that interact with 3xFLAG-DLC-1 as identified by immunoprecipitation followed by RNA sequencing.	DESeq2, fold change > 2,, p-value < 0.01	WBPaper00055334:DLC-1_interacting

1 Sequence

• Length: 817

1 Sequence Ontology Term