WormMine: Gene WBGene00001501

• WormBase Gene ID: WBGene00001501
• Gene Name: ftn-2
• Sequence Name: D1037.3
• Brief Description: ftn-2 encodes one of two C. elegans ferritin heavy chain homologs; loss of ftn-2 activity via deletion mutation results in slightly lower brood sizes and, under iron stress conditions, slightly faster growth from the L4 to adult stage of development, and slightly reduced lifespan; an ftn-2::gfp reporter fusion is expressed in diverse tissues, including the pharynx, intestine, and hypodermis, and its expression, along with that of ftn-2 mRNA, does not appear to change significantly under iron stress conditions.
• Organism: Caenorhabditis elegans
• Automated Description: Enables identical protein binding activity. Involved in defense response to Gram-positive bacterium. Predicted to be located in cytoplasm. Expressed in body wall musculature and hypodermis. Human ortholog(s) of this gene implicated in several diseases, including hemochromatosis type 5; hyperferritinemia-cataract syndrome; and neurodegeneration with brain iron accumulation 3. Is an ortholog of human FTMT (ferritin mitochondrial).
• Biotype: SO:0001217
• Genetic Position: I :-2.93309 ±0.018064
• Length (nt): 748

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001501

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:D1037.3.1	D1037.3.1	651	I: 3680180-3680927

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:D1037.3	D1037.3	513	I: 3680290-3680391

10 RNAi Result

• WBRNAi00067721
• WBRNAi00043364
• WBRNAi00069754
• WBRNAi00003267
• WBRNAi00033297
• WBRNAi00116826
• WBRNAi00102059
• WBRNAi00102060
• WBRNAi00089360
• WBRNAi00089349

16 Allele

• gk963902
• gk964159
• gk893721
• gk662444
• gk662445
• gk456526
• gk461211
• gk865150
• WBVar01280760
• WBVar01280759
• WBVar01280763
• ok404
• gk802099
• gk1314
• gk376016
• WBVar00097660

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001501
• Start: 3680180
• End: 3680927
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_3671701..3680179
• Length (nt): 8479
• Chromosome Location: I: 3671701-3680179
• Organism: Caenorhabditis elegans

216 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Genes that were downregulated in lin-15B(n744).	For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis.	WBPaper00038168:lin-15B(n744)_downregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes up regulated in alg-1(gk214) comparing to in N2.	Differential expression was assessed using an empirical Bayes statistics using the eBayes function.	WBPaper00040823:alg-1(gk214)_upregulated
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h

10 Expression Patterns

• Primary Identifier: Expr4744
• Pattern: Basal expression of the ferritin-2 gene showed a broad spatial distribution of gene expression, predominantly, in the intestinal tract of adult nematodes, with the highest expression observed at the proximal and the distal ends. ferritin-2 transcript expression did not appear to be significantly induced by phosphine exposure and the distribution of gene expression remained unchanged as well.

• Primary Identifier: Expr1030901
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr5610
• Remark: Strain: BC14291
• Reporter Gene: [ftn-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCGTTTGAATTTTCTGTTCCA] 3' and primer B 5' [GATGGTAGTTTGTGGCTGGTAAG] 3'.
• Pattern: Adult Expression: pharynx; intestine; Larval Expression: pharynx; intestine

• Primary Identifier: Expr3081
• Remark: Gene Regulation: ftn-2 expression level was not significantly changed by iron treatment even though the spot number was slightly increased. The level of GFP expression was consistently different between ftn-1::gfp and ftn-2::gfp transformed animals. Although a slight variation was observed among transformed animals, it appeared that GFP expression level was relatively lower in ftn-1::gfp animals than in ftn-2::gfp.
• Pattern: ftn-2::gfp was expressed in diverse tissues, including the pharynx, body wall muscle and hypodermis except the intestine.

• Primary Identifier: Expr7855
• Remark: Picture: Fig. 2C.
• Pattern: ftn-2::GFP-his is highly expressed in intestinal cells in all larval stages and in adults. Expression of ftn-2::GFP-his in embryos is detected in late gastrulation. Weak expression of ftn-2::GFP-his is also observed in hypodermal cells in most larval stages.

• Primary Identifier: Expr2011914
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1229
• Remark: Original chronogram file: chronogram.2351.xml
• Reporter Gene: [D1037.3:gfp] transcriptional fusion.

• Primary Identifier: Expr2030151
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1022759
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1147349
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

17 GO Annotation

50 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001501
• Start: 3680180
• End: 3680927
• Strand: -1

17 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 748

1 Sequence Ontology Term