WormMine: Gene WBGene00001887

• WormBase Gene ID: WBGene00001887
• Gene Name: his-13
• Sequence Name: ZK131.7
• Brief Description: his-13 encodes an H3 histone; his-13 is contained within the histone gene cluster HIS3.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA binding activity and protein heterodimerization activity. Predicted to be a structural constituent of chromatin. Predicted to be part of nucleosome. Is an ortholog of several human genes including H3C1 (H3 clustered histone 1); H3C3 (H3 clustered histone 3); and H3C4 (H3 clustered histone 4).
• Biotype: SO:0001217
• Genetic Position: II :20.3±
• Length (nt): 411

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001887

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:ZK131.7.1	ZK131.7.1	411	II: 13820210-13820620

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:ZK131.7	ZK131.7	411	II: 13820210-13820620

12 RNAi Result

• WBRNAi00027050
• WBRNAi00044046
• WBRNAi00086823
• WBRNAi00021880
• WBRNAi00082052
• WBRNAi00082057
• WBRNAi00111707
• WBRNAi00111926
• WBRNAi00111770
• WBRNAi00025037
• WBRNAi00111771
• WBRNAi00027054

3 Allele

• gk963801
• gk963053
• gk962684

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001887
• Start: 13820210
• End: 13820620
• Strand: 1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_13820621..13821197
• Length (nt): 577
• Chromosome Location: II: 13820621-13821197
• Organism: Caenorhabditis elegans

102 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
Bacteria: E.faecalis strain OG1RF	Transcripts that showed significantly increased expression after infection by E. faecalis OG1RF.	Ballgown was used to calculate differential expression of genes using FPKM data and to generate tables with fold change and P values. Genes were shortlisted with a cutoff of 2-fold change and P values of less than 0.05.	WBPaper00059754:E.faecalis_OG1RF_upregulated
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression after 24 hours of induction of human beta Amyloid at young adult stage	A 2-fold change in expression level and a false discovery rate analog of p < 0.05.	WBPaper00064130:Beta-Amyloid_24h_upregulated_mRNA
	Transcripts that showed significantly decreased expression in daf-16(mgDf50) comparing to in N2 at L1 larva stage.	DESeq v1.20.0 was used to analyze differential gene expression. Transcripts with adjusted p-value < 0.05 were considered differentialled expressed.	WBPaper00048971:daf-16(mgDf50)_downregulated_L1
Heat Shock: 35C 4 hours at L4 larva stage.	Transcripts that showed significantly decreased expression after L4 larva N2 animals were heat stressed at 35C for 4 hours	DESeq2	WBPaper00057154:HeatShock_downregulated_mRNA
	Transcripts that showed significantly increased expression in animals with germline-specific inx-14(RNAi) comparing to in aniamls fed with control vector, both exposed to PA14 infection.	DESeq2. Differentially-expressed genes (DEG) were identified based on two criteria: FDR (False discovery rateusing Benjamini-Hochberg adjusted p-values) < 0.01 and absolute value of log2(Fold Change) > 1.	WBPaper00066146:germline-inx-14(RNAi)_upregulated_PA14
	Transcripts that showed significantly increased expression in mbl-1(syb4345), referred to as mbl-1long(ex7+), comparing to in N2 at L4 larva stage.	DESeq2, Fold change > 2 and FDR < 0.05	WBPaper00066410:mbl-1(syb4345)_upregulated
	Transcriptions that showed significantly increased expression in skn-1(RNAi) comparing to empty vector injection into rrf-3(pk1426);daf-2(e1368) animals.	Genes with an absolute fold changeof at least 2 and standard p-values below 0.05 were considered as differentially expressed.	WBPaper00062193:skn-1(RNAi)_upregulated
	Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:eat-2(ad1116)_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Allantoin_downregulated
	Transcripts that showed significantly increased expression in hira-1(gk835598) comparing to in N2 animals at L4 larva stage.	Differential expression analysis was done with Rversion 2.15.3 using DESeq_1.10.1. Fold change > 2, p-value < 0.01.	WBPaper00059739:hira-1(gk835598)_upregulated_L4
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Proteins interacting with HA-PPM-1.D.	N.A.	WBPaper00062498:PPM-1.D_interacting
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to nitroguanidine (NQ).	Multivariate permutation tests with random variance model implemented in BRB-Array Tools version 4.5 were performed to infer differentially expressed genes (DEGs). One thousand random permutations were computed per chemical class (i.e., a group of 16 arrays or samples). The confidence level of false discovery rate assessment was set at 80%, and the maximum allowed portion of false-positive genes was 10%.	WBPaper00055899:nitroguanidine_regulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly increased expression in emb-4(hc60) comparing to in N2.	DESeq2	WBPaper00052884:emb-4(hc60)_upregulated
	Transcripts that showed significantly increased expression in sams-3(RNAi) comparing to N2 animals injected with empty vector.	Deseq FDR < 0.01, fold change > 2.	WBPaper00065005:sams-3(RNAi)_upregulated
	Transcripts that showed significantly increased exression in animals exposed to 100uM cadmium for 24 hours.	DESeq2 v1.20.0, fold change > 2, FDR < 0.05.	WBPaper00065029:cadmium_upregulated
	Transcripts that showed significantly decreased expression in hsf-1(RNAi) animals comparing to in control animals, without heat shock.	Transcripts that were differentially expressed in different conditions, compared to the hsf-1(+);-HS control, were determined with CuffDiff, which uses the Benjamini-Hochberg correction for multiple testing to obtain the q-value (the FDR-adjusted the p-value).	WBPaper00049942:hsf-1(RNAi)_downregulated
	Embryonic class (E): genes that significantly increase in abundance at some point during embryogenesis.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_E

2 Expression Patterns

• Primary Identifier: Expr1162655
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr7195
• Remark: Also expressed in (comments from author) : Note: primers are not unique and produce 3 products. Strain: BC15299
• Reporter Gene: [his-13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAATACCTTCCTTCAGCATGT] 3' and primer B 5' [GCTTAGTACGAGCGATGATGC] 3'.
• Pattern: Larval Expression: Nervous System; head neurons

4 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001887
• Start: 13820210
• End: 13820620
• Strand: 1

4 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 411

1 Sequence Ontology Term