WormMine: Gene WBGene00003154

• WormBase Gene ID: WBGene00003154
• Gene Name: mcm-2
• Sequence Name: Y17G7B.5
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable single-stranded DNA binding activity. Predicted to contribute to 3'-5' DNA helicase activity and single-stranded DNA helicase activity. Predicted to be involved in DNA unwinding involved in DNA replication; double-strand break repair via break-induced replication; and mitotic DNA replication initiation. Located in condensed chromosome and pronucleus. Expressed in excretory cell; intestine; and uterus. Human ortholog(s) of this gene implicated in Alzheimer's disease and autosomal dominant nonsyndromic deafness 70. Is an ortholog of human MCM2 (minichromosome maintenance complex component 2).
• Biotype: SO:0001217
• Genetic Position: II :5.67515 ±0.063403
• Length (nt): 5117

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003154

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y17G7B.5a.1	Y17G7B.5a.1	2827	II: 12001509-12006625

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y17G7B.5a	Y17G7B.5a	2646	II: 12001673-12002045

14 RNAi Result

• WBRNAi00095770
• WBRNAi00070321
• WBRNAi00009295
• WBRNAi00036674
• WBRNAi00075569
• WBRNAi00075570
• WBRNAi00055584
• WBRNAi00066437
• WBRNAi00026604
• WBRNAi00070318
• WBRNAi00066196
• WBRNAi00070320
• WBRNAi00070319
• WBRNAi00096852

132 Allele

• gk963801
• gk963053
• gk962684
• gk963539
• WBVar01605222
• WBVar01547306
• WBVar01547305
• WBVar01655391
• WBVar01538806
• WBVar01538805
• WBVar02084888
• WBVar01246015
• WBVar01246016
• WBVar01246013
• WBVar01246014
• WBVar01246019
• WBVar01246020
• WBVar01246018
• WBVar01246023
• WBVar01246021
• WBVar00269089
• WBVar01246022
• gk870227
• gk836913
• WBVar02033725
• WBVar02033726
• WBVar02033724
• gk813432
• gk418500
• gk513124

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003154
• Start: 12001509
• End: 12006625
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

221 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly decreased expression in hsp-6(mg585) comparing to in N2 at L4 larva stage.	EdgeR, fold change > 2, FDR < 0.001.	WBPaper00056290:hsp-6(mg585)_downregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
Transgeneration hypoxia treatment.	Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage.	For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR.	WBPaper00064871:hypoxia_upregulated_F1
Heat Shock: 35C 4 hours at L4 larva stage.	Transcripts that showed significantly decreased expression after L4 larva N2 animals were heat stressed at 35C for 4 hours	DESeq2	WBPaper00057154:HeatShock_downregulated_mRNA
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Genes down regulated by mir-243(n4759).	RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243.	WBPaper00036130:mir-243_down_regulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure at 25C.	Transcripts that showed significantly increased expression in N2 animals with 24 hours of exposure to P. aeruginosa PA14 for 24 hrs at 25C, comparing to N2 animals without exposure to PA14.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00058948:PA14_upregulated
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated

11 Expression Patterns

• Primary Identifier: Expr1031489
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6899
• Remark: Strain: BC12790
• Reporter Gene: [mcm-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATAGCCATGGCCTAACTTTCTC] 3' and primer B 5' [GCACGATCAGCGATTGTTAGTA] 3'.
• Pattern: Adult Expression: intestine; Nervous System; pharyngeal neurons; Larval Expression: intestine; Reproductive System; developing vulva; developing uterus; seam cells; Nervous System; pharyngeal neurons

• Primary Identifier: Expr6898
• Remark: Strain: BC10518
• Reporter Gene: [mcm-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATAGCCATGGCCTAACTTTCTC] 3' and primer B 5' [GCACGATCAGCGATTGTTAGTA] 3'.
• Pattern: Adult Expression: intestine - . cells; Nervous System; head neurons; Larval Expression: intestine; Nervous System; head neurons; unidentified cells in body

• Primary Identifier: Expr2107
• Pattern: Expression is seen in all stages from early embryo, but is mosaic and sporadic. Expression is seen in the intestine, uterus, excretory cell and other cells.

• Primary Identifier: Expr9923
• Subcellular Localization: GFP-MCM-3 became enriched on chromosomes during anaphase of meiosis II and during meta- phase and anaphase of mitosis. GFP-MCM-3 was also massively accumulated in pronuclei and nuclei during interphase and prophase. Worms expressing GFP-MCM-2 showed an identical localization to that of GFP-MCM-3 during the first embryonic cell cycle, consistent with both of them being part of the hexameric MCM- 2-7 complex. The pan-MCM antibodies also showed additional centrosome staining, which might either be unspecific or a result of the location of MCM subunits other than MCM-3 and MCM-7.

• Primary Identifier: Expr2013449
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1010240
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2031683
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1159090
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram1894
• Remark: Original chronogram file: chronogram.81.xml
• Reporter Gene: [Y17G7B.5:gfp] transcriptional fusion.

• Primary Identifier: Expr15308
• Subcellular Localization: The RSKS-1-GFP, MCM-2-GFP, EIF-1-GFP, LET-502-GFP, RAGA-1-GFP, and GFP-SAC-1 fusion proteins appeared punctate in the epithelial intestine and localized to distinct cytoplasmic puncta resembling endosomes.

28 GO Annotation

6 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003154
• Start: 12001509
• End: 12006625
• Strand: -1

28 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5117

1 Sequence Ontology Term