WormMine: Gene WBGene00004391

• WormBase Gene ID: WBGene00004391
• Gene Name: rnr-1
• Sequence Name: T23G5.1
• Brief Description: rnr-1 encodes the large subunit of ribonucleotide reductase; by homology, RNR-1 is predicted to function in deoxyribonucleotide biosynthesis; in C. elegans rnr-1 is an essential gene whose activity is required for reproduction and embryonic development.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable ATP binding activity and ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor. Predicted to be involved in deoxyribonucleotide biosynthetic process. Predicted to be part of ribonucleoside-diphosphate reductase complex. Expressed in head; somatic gonad precursor; and tail. Human ortholog(s) of this gene implicated in chronic progressive external ophthalmoplegia and lung non-small cell carcinoma. Is an ortholog of human RRM1 (ribonucleotide reductase catalytic subunit M1).
• Biotype: SO:0001217
• Genetic Position: III :0.326335 ±0.008197
• Length (nt): 3460

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004391

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T23G5.1.2	T23G5.1.2	2633	III: 9225339-9228798
Transcript:T23G5.1.1	T23G5.1.1	2515	III: 9225375-9228250

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T23G5.1	T23G5.1	2367	III: 9225521-9226100

25 RNAi Result

• WBRNAi00085406
• WBRNAi00073832
• WBRNAi00073833
• WBRNAi00073834
• WBRNAi00073835
• WBRNAi00073836
• WBRNAi00073837
• WBRNAi00073838
• WBRNAi00073831
• WBRNAi00072658
• WBRNAi00072659
• WBRNAi00072660
• WBRNAi00035888
• WBRNAi00107906
• WBRNAi00116050
• WBRNAi00009217
• WBRNAi00107908
• WBRNAi00107904
• WBRNAi00053975
• WBRNAi00002590
• WBRNAi00008172
• WBRNAi00026385
• WBRNAi00096937
• WBRNAi00096995
• WBRNAi00110905

36 Allele

• gk964518
• gk963887
• otn11117
• WBVar00070453
• gk813490
• gk541651
• gk536866
• gk808087
• gk744047
• gk478456
• gk555600
• gk569367
• gk918381
• gk460426
• gk878610
• gk648167
• gk344559
• gk610944
• gk847143
• gk639291
• gk408642
• tm3025
• h17768
• WBVar01447440
• WBVar00233990
• WBVar01629259
• WBVar01629260
• WBVar01409097
• WBVar01896377
• gk181680

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004391
• Start: 9225339
• End: 9228798
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_9215468..9225338
• Length (nt): 9871
• Chromosome Location: III: 9215468-9225338
• Organism: Caenorhabditis elegans

238 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria diet: Escherichia coli HB101. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:HB101_downregulated
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
Heat Shock: 35C 4 hours at L4 larva stage.	Transcripts that showed significantly decreased expression after L4 larva N2 animals were heat stressed at 35C for 4 hours	DESeq2	WBPaper00057154:HeatShock_downregulated_mRNA
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Genes down regulated by mir-243(n4759).	RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243.	WBPaper00036130:mir-243_down_regulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated

11 Expression Patterns

• Primary Identifier: Expr6751
• Remark: Strain: BC12610
• Reporter Gene: [rnr-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGAAAATTCGCAATCACAG] 3' and primer B 5' [TTGTAACGTTGGATAACTGGAAAA] 3'.
• Pattern: Adult Expression: hypodermis; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; Reproductive System; developing vulva; hypodermis; seam cells; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr6752
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11321
• Reporter Gene: [rnr-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGAAAATTCGCAATCACAG] 3' and primer B 5' [TTGTAACGTTGGATAACTGGAAAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: intestine; body wall muscle; Nervous System; nerve ring; head neurons; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr1019965
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1032202
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr8343
• Remark: Picture: Figure 4A left.
• Pattern: Significant upregulation of rnr-1 transcription was observed during germline proliferation in wild-type hermaphrodites between the L4 larval and young adult stages.

• Primary Identifier: Expr8344
• Remark: Picture: Figure 4A right.
• Pattern: Significant upregulation of rnr-2 transcription was observed during germline proliferation in wild-type hermaphrodites between the L4 larval and young adult stages.

• Primary Identifier: Chronogram275
• Remark: Original chronogram file: chronogram.13.xml
• Reporter Gene: [T23G5.1:gfp] transcriptional fusion.

• Primary Identifier: Expr12421
• Pattern: In wild-type L1 larvae, rnr::GFP expression first begins in the SGPs approximately 6 hr after hatching, and also occurs in other dividing cells.

• Primary Identifier: Expr2015398
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1157521
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2033632
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

14 GO Annotation

7 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004391
• Start: 9225339
• End: 9228798
• Strand: -1

14 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3460

1 Sequence Ontology Term