WormMine: Gene WBGene00004778

• WormBase Gene ID: WBGene00004778
• Gene Name: ser-3
• Sequence Name: K02F2.6
• Brief Description: ser-3 encodes an octopamine receptor; ser-3 is required in the SIA neurons for response to the absence of food and to exogenous octopamine; SER-3 also mediates along with SER-4, the dietary restriction-based, lifespan-extending effects of mianserin, an antidepressant, on C. elegans; when expressed in HEK293 cells, SER-3 mediates a response to octopamine and to tyramine, but not serotonin; in addition, ser-3 is required for normal inhibition of movement by 5-HT, with ser-3 mutants being hyperactive and excessively curling their male tails (but this phenotype is reversed by exogenous 5-HT, with ser-3 mutants then becoming sluggish); ser-3 activity is also required for normally high brood sizes and for embryonic development, and weakly required for pharyngeal pumping; SER-3 is expressed in pharynx, head and tail neurons, nerve ring, and intestine.
• Organism: Caenorhabditis elegans
• Automated Description: Enables octopamine receptor activity. Involved in octopamine or tyramine signaling pathway. Predicted to be located in dendrite and plasma membrane. Expressed in several structures, including ASH; SIA; head muscle; hermaphrodite gonad; and lumbar ganglion.
• Biotype: SO:0001217
• Genetic Position: I :1.33662 ±0.005477
• Length (nt): 2577

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004778

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:K02F2.6.1	K02F2.6.1	2180	I: 6820517-6823093

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:K02F2.6	K02F2.6	1833	I: 6820763-6820912

27 RNAi Result

• WBRNAi00049739
• WBRNAi00049740
• WBRNAi00072216
• WBRNAi00069738
• WBRNAi00075273
• WBRNAi00075274
• WBRNAi00083581
• WBRNAi00073169
• WBRNAi00073171
• WBRNAi00001893
• WBRNAi00003902
• WBRNAi00064217
• WBRNAi00033883
• WBRNAi00082555
• WBRNAi00069712
• WBRNAi00082629
• WBRNAi00083686
• WBRNAi00083854
• WBRNAi00073170
• WBRNAi00069734
• WBRNAi00064191
• WBRNAi00069696
• WBRNAi00069704
• WBRNAi00069720
• WBRNAi00069728
• WBRNAi00083526
• WBRNAi00083493

33 Allele

• gk962858
• gk962706
• gk963902
• otn9327
• gk953557
• gk113736
• gk113737
• gk113738
• ok1995
• gk113739
• gk113740
• ok2007
• gk674295
• gk457022
• gk889938
• gk499778
• gk484149
• gk937796
• gk458015
• gk459728
• ad1774
• gk591429
• gk762323
• gk482788
• gk473426
• gk789485
• h10193
• gk641688
• gk410169
• gk556052

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004778
• Start: 6820517
• End: 6823093
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

126 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
Bacteria infection: Photorhabdus luminescens	Genes down-regulated in animals infected with Photorhabdus luminescens compared to the E. coli OP50 control after 24h of infection.	MAANOVA and BRB-Array-Tools.	WBPaper00030985:Photorhabdus_luminescens_downregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
	Transcripts that showed significantly increased expression in nuo-6(qm200) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:nuo-6(qm200)_upregulated
	Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:mep-1(ne4629)_upregulated
	Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain.	RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis.	WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral

11 Expression Patterns

• Primary Identifier: Expr6308
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC11545
• Reporter Gene: [ser-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACCTAAAAAGTTCTCCGGATCT] 3' and primer B 5' [TCTCATCCATTCGATAATTTTGTT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: intestine; Nervous System; nerve ring; head neurons; tail neurons

• Primary Identifier: Expr14335
• Pattern: As previously reported (Suo et al., 2006; Yoshida et al., 2014), ser-3 and ser-6 were expressed in a number of neurons including the SIA neurons in hermaphrodites. octr-1 was also expressed in the SIA neurons of hermaphrodites. Furthermore, expression of ser-3, ser-6, and octr-1 in the SIA neurons was similarly observed in males.

• Primary Identifier: Expr10640
• Pattern: ser-3::ser-3::gfp was expressed in multiple neurons, including the ASHs.

• Primary Identifier: Expr1032369
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr8275
• Remark: No detailed description on expression patterns in other life stages.. Picture: Fig. 5.
• Pattern: GFP expression was observed in various tissues, including many neurons in the head and tail, head muscles, intestine, phasmid socket cells, spermatheca, and eggs. A weak expression was also observed in the cells of the gonad and vulva. The neurons expressing ser-3 promoter-driven GFP in the tail were identified as PHA, PHB, and PVQ neurons.

• Primary Identifier: Expr1153460
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1010187
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2716
• Remark: Reporter gene fusion type not specified.
• Pattern: The reporter gene construct showed a very restricted expression pattern almost exclusively in a subset of head and tail neurons.

• Primary Identifier: Expr2015748
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1581
• Remark: Original chronogram file: chronogram.463.xml
• Reporter Gene: [K02F2.6:gfp] transcriptional fusion.

• Primary Identifier: Expr2033981
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

20 GO Annotation

9 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004778
• Start: 6820517
• End: 6823093
• Strand: -1

20 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2577

1 Sequence Ontology Term