WormMine: Gene WBGene00004880

• WormBase Gene ID: WBGene00004880
• Gene Name: smg-2
• Sequence Name: Y48G8AL.6
• Organism: Caenorhabditis elegans
• Automated Description: Enables protein phosphatase 2A binding activity. Involved in embryonic genitalia morphogenesis and negative regulation of gene expression. Located in cytoplasm and nucleus. Expressed in intestinal cell and muscle cell. Is an ortholog of human UPF1 (UPF1 RNA helicase and ATPase).
• Biotype: SO:0001217
• Genetic Position: I :-16.9122 ±0.119036
• Length (nt): 14357

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004880

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y48G8AL.6.1	Y48G8AL.6.1	4675	I: 1176473-1190829

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y48G8AL.6	Y48G8AL.6	3210	I: 1176475-1176621

15 RNAi Result

• WBRNAi00084797
• WBRNAi00094405
• WBRNAi00056970
• WBRNAi00084792
• WBRNAi00075330
• WBRNAi00094396
• WBRNAi00093539
• WBRNAi00027770
• WBRNAi00116693
• WBRNAi00069209
• WBRNAi00075535
• WBRNAi00091909
• WBRNAi00069208
• WBRNAi00069210
• WBRNAi00069865

479 Allele

• gk963902
• gk963630
• gk963701
• r863
• r866
• r865
• r868
• r870
• r875
• r877
• r881
• r882
• r890
• r893
• r895
• r898
• r908
• r907
• r912
• r920
• WBVar01691540
• WBVar01691541
• WBVar02124078
• WBVar02124079
• WBVar01694329
• WBVar01694330
• WBVar01694334
• WBVar01694333
• WBVar01694332
• WBVar01694331

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004880
• Start: 1176473
• End: 1190829
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

100 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Heat shock: 35C for 1 hour.	Transcripts that showed significantly increased expression immediately after 1-day post L4 adult hermaphrodite endu-2(tm4977) animals were exposed to 35C for 1 hour.	The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01.	WBPaper00065749:Heat-Shock_upregulated_endu-2(tm4977)
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
Transgeneration hypoxia treatment.	Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage.	For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR.	WBPaper00064871:hypoxia_upregulated_F1
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
Bacteria: B.thuringiensis	Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (FLT) starting at L1 lava stage.	DESeq	WBPaper00053302:alovudine_24h_regulated
	Transcripts that showed significantly increased expression in jmjd-3.1p::jmjd-3.1 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:jmjd-3.1(+)_upregulated
	Transcripts that showed significantly increased expression in rgef-1p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:rgef-1p-jmjd-1.2(+)_upregulated
	Transcripts that showed significantly increased expression in sur-5p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:sur-5p-jmjd-1.2(+)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L1-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L1-larva_expressed
	Transcripts that showed significantly decreased expression in pals-22(jy3) comparing to in N2 at L4 larva stage.	Differential expression analysis was performed in RStudio (v1.1.453) using R (v3.50) and Bioconductor (v3.7) packages. As outlined in the RNAseq123 vignette, data was imported, filtered and normalized using edgeR, and linear modeling and differential expression analysis was performed using limma. An FDR cutoff of <0.01 was used to define differentially expressed genes; no fold-change criteria was used.	WBPaper00056034:pals-22(jy3)_downregulated
	Genes downregulated in dcr-1(-/-) adult animals by at least 1.5 fold and P < 0.01, as determined by a multisample t-test and the Benjamini and Hochberg false discovery rate correction.	Statistical t-test: P < 0.05 for rde-4(-/-) and rde-1(-/-) analyses; P < 0.01 for dcr-1(-/-) analysis with a threshold of 1.5-fold misregulation.	WBPaper00029437:dcr-1_downregulated
Exposure to Au-NP.	Genes with differeiential expression after exposed to Au-NP.	Hierarchical clustering was performed in Partek to confirm that the samples match to the treatment groups. Analysis of variance (ANOVA) was used to partition the variance due to treatment from technical and biological noise. The list of differentially expressed genes was generated by identifying the genes showing fold change of more than 1.5 and less than -1.5 at p < 0.05 with and without multiple sample correction, False Discovery Rate (FDR). False discovery correction according to Benjamini and Hochberg produced a list of 37 significant transcripts. FDR was not applied when selecting differential expressed genes, because this approach can increase the type II error and result in elimination of the genes responsive to the treatment.	WBPaper00040821:Au-NP_regulated
	Genes depleted in muscle cells (24hr muscle dataset). Dissociated myo-3::GFP embryos were cultured for 24 hours before FACS sorting.	A two-class unpaired analysis was performed to identify genes that are elevated 1.7-fold or greater when compared with the reference for each dataset, at a false discovery rate of 1.8% or less for M0 and 1.2% or less for the M24 datasets.	WBPaper00031003:24hr_muscle_depleted
	Total muscle depleted genes (complete list of non-overlapping genes from the 0hr and 24hr muscle depleted datasets).	A two-class unpaired analysis was performed to identify genes that are elevated 1.7-fold or greater when compared with the reference for each dataset, at a false discovery rate of 1.8% or less for M0 and 1.2% or less for the M24 datasets.	WBPaper00031003:total_muscle_depleted

8 Expression Patterns

• Primary Identifier: Expr2034141
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr13326
• Pattern: SMG-2::GFP was expressed in the cytoplasm of cells, consistent with the finding that NMD functions in the cytoplasm. Tissues that expressed the smg-2::gfp transgene included neurons, intestine and muscles.

• Primary Identifier: Expr7011
• Remark: Also expressed in (comments from author) : No comments. Strain: BC13697
• Reporter Gene: [smg-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATCAAACATTTTAGAGTTTTCCC] 3' and primer B 5' [GAAGAAAAGTGCGTTTTTGAGG] 3'.
• Pattern: Larval Expression: Nervous System; head neurons; neurons along body

• Primary Identifier: Expr7979
• Remark: Expression is eliminated in smg-2(r908) (r908 is a null allele). Picture: Fig. 6A.
• Subcellular Localization: SMG-2 is located diffusely throughout the cytoplasm in the wild type.

• Primary Identifier: Expr1032419
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2015908
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1018867
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1160418
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

34 GO Annotation

11 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004880
• Start: 1176473
• End: 1190829
• Strand: 1

34 Ontology Annotations

4 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with significant increase of expression in UPF1 smg-2(RNAi) comparing to control.	Bioconductor package LIMMA was used to determine differentially expressed genes. The P-values were adjusted for multiple testing with a false-discovery rate (50). Probe sets with fold-change > 1.5 and q-value < 0.05 were used as a cut-off for C. elegans microarrays	WBPaper00042561:smg-2(RNAi)_upregulated
	Transcripts that did not alter expression in smg-1(r910) and smg-1(r910) smg-2(r915) mutants comparing to in N2, but their mRNAs co-purify with SMG-2.	edgeR	WBPaper00053308:SMG-2_associated_NMD(-)_unaltered_ClassII
	Genes with significant decrease of expression in UPF1 smg-2(RNAi) comparing to control.	Bioconductor package LIMMA was used to determine differentially expressed genes. The P-values were adjusted for multiple testing with a false-discovery rate (50). Probe sets with fold-change > 1.5 and q-value < 0.05 were used as a cut-off for C. elegans microarrays	WBPaper00042561:smg-2(RNAi)_downregulated
	Transcripts that showed increased expression in smg-1(r910) and smg-1(r910) smg-2(r915) mutants comparing to in N2, and their mRNAs co-purify with SMG-2.	edgeR	WBPaper00053308:SMG-2_associated_NMD(-)_upregulated_ClassI

1 Sequence

• Length: 14357

1 Sequence Ontology Term