WormMine: Gene WBGene00006537

• WormBase Gene ID: WBGene00006537
• Gene Name: tbb-2
• Sequence Name: C36E8.5
• Brief Description: tbb-2 encodes a homolog of mammalian beta-tubulin (TUBB) that is expressed at high levels in the germline; TBB-2 is redundant for embryonic viability, due to its paralog TBB-1; however, unlike its paralog TBB-1 it is preferred for normal microtubule severing by the katanin complex MEI-1/MEI-2; TBB-2 is required together with TBB-1, TBA-1, and tba-2 to make spindle structures in embryos and TBB-2 also affects the stability of the PO spindle; first divisions are normal in null mutants, but putative gain-of-function mutations affect centrosome rotations in the P0, P1, and EMS blastomeres of the early embryo, and affect pronuclear migration and meiosis.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable GTP binding activity. Predicted to be a structural constituent of cytoskeleton. Involved in meiotic spindle organization. Located in spindle microtubule. Expressed in several structures, including germ line; gonad; oocyte; tail; and touch receptor neurons. Human ortholog(s) of this gene implicated in complex cortical dysplasia with other brain malformations 1 and congenital fibrosis of the extraocular muscles 3A. Is an ortholog of several human genes including TUBB3 (tubulin beta 3 class III); TUBB6 (tubulin beta 6 class V); and TUBB8B (tubulin beta 8B).
• Biotype: SO:0001217
• Genetic Position: III :-4.0282 ±0.006633
• Length (nt): 1718

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006537

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C36E8.5.1	C36E8.5.1	1514	III: 4015910-4017627

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C36E8.5	C36E8.5	1353	III: 4016066-4016259

50 RNAi Result

• WBRNAi00067013
• WBRNAi00067039
• WBRNAi00067237
• WBRNAi00067701
• WBRNAi00077524
• WBRNAi00082437
• WBRNAi00099909
• WBRNAi00066715
• WBRNAi00088834
• WBRNAi00064965
• WBRNAi00090814
• WBRNAi00084092
• WBRNAi00078817
• WBRNAi00082639
• WBRNAi00100742
• WBRNAi00101237
• WBRNAi00101275
• WBRNAi00101294
• WBRNAi00099303
• WBRNAi00099505
• WBRNAi00099707
• WBRNAi00101256
• WBRNAi00101097
• WBRNAi00111124
• WBRNAi00076203
• WBRNAi00033404
• WBRNAi00002431
• WBRNAi00002775
• WBRNAi00024759
• WBRNAi00042080

24 Allele

• qt1
• sb26
• t1623
• t1673
• gk964165
• gk130
• gk129
• or362
• tj41
• gk392717
• ju1535
• gk469244
• gk607688
• gk855859
• gk171992
• gk955520
• gk876732
• gk171991
• gk557649
• gk651782
• or600
• gk171990
• WBVar01913270
• WBVar00099197

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006537
• Start: 4015910
• End: 4017627
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_4015780..4015909
• Length (nt): 130
• Chromosome Location: III: 4015780-4015909
• Organism: Caenorhabditis elegans

207 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Top 300 transcripts enriched in excretory duct, excretory pore according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:Excretory_duct_and_pore
Transgeneration hypoxia treatment.	Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage.	For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR.	WBPaper00064871:hypoxia_upregulated_F1
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva.	Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage.	DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3.	WBPaper00058958:100mGy-irradiation-72h_upregulated

12 Expression Patterns

• Primary Identifier: Expr2035453
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5453
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11439
• Reporter Gene: [tbb-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAAACATATCGAGGCTGAAAATC] 3' and primer B 5' [TTGCTGAAAAGGTCGTAATGAAT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; Reproductive System; uterus; vulva other; spermatheca uterine valve; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; Reproductive System; developing vulva; developing uterus; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr2719
• Pattern: TBB-2 was expressed throughout the female gonad, from the distal syncytial arm to maturing oocytes. TBB-2 expression was not germline and embryo specific, since the protein was also expressed in a glp-1 mutant, which lack germ line and fertilized embryos. TBB-2 was detected post-embryonically in larval and adult neuronal tissues.
• Subcellular Localization: TBB-2 was expressed in every subset of spindle microtubules recognized by the generic anti-alpha-tubulin antibody, including spindle midzone and astral microtubules. TBB-2 expression persisted in mitotic spindles and asters throughout embryogenesis, beyond the end of the temperature-sensitive period of mei-1(ct46gf).

• Primary Identifier: Expr1032686
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr4038
• Remark: Curated by authors based on online in-situ hybridization database (Y. Kohara, personal communication; http://nematode.lab.nig.ac.jp).
• Pattern: Broadly expressed in gonad/soma.

• Primary Identifier: Expr13374
• Pattern: With conventional transcriptional fusions we detected fluorescence from expression of the tbb-2 promoter throughout the body as well as in the TRNs.

• Primary Identifier: Expr1025867
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1146078
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2017318
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr554
• Remark: Clone cm01d4 Maternal mRNA.
• Pattern: Ubiquitous staining until the 550-cell stage, decreasing with age. After 100-cell stage, could not detect if a minority of cells were unstained. Many unidentified cells stained in bean through pretzel stage.

• Primary Identifier: Chronogram1550
• Remark: Original chronogram file: chronogram.421.xml
• Reporter Gene: [C36E8.5:gfp] transcriptional fusion.

• Primary Identifier: Expr3452
• Remark: An interesting contrast in the behaviors of centrosomal gamma- and beta-tubulins was seen in the timing of the appearance of darkened centers. With GFP::beta-tubulin, ring profiles could be seen in prometaphase and metaphase. With anti-gamma-tubulin and GFP::gamma-tubulin, they were not seen until anaphase. This suggests that despite the presence of gamma-tubulin throughout the centrosome during spindle assembly, most recruitment and polymerization of alpha/beta-tubulin dimers occurs in the outer layers.
• Subcellular Localization: The dynamic behavior of centrosomes seen with GFP::beta-tubulin was similar to that seen with GFP::gamma-tubulin (see Expr3451). Centrosomes recruited GFP::beta-tubulin and enlarged from prophase through metaphase. They showed ring-like profiles with darkened centers, and during anaphase to telophase, the posterior ring underwent swinging, posterior migration, flattening, and fragmentation. Two small dots of GFP::beta-tubulin, presumably the daughter centrosomes, could be seen within the expanding rings during anaphase to telophase.

20 GO Annotation

22 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006537
• Start: 4015910
• End: 4017627
• Strand: -1

20 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1718

1 Sequence Ontology Term