WormMine: Gene WBGene00008140

• WormBase Gene ID: WBGene00008140
• Gene Name: xpf-1
• Sequence Name: C47D12.8
• Brief Description: xpf-1 encodes an ortholog of the DNA repair protein XPF/ERCC4, which when mutated in humans leads to Xeroderma Pigmentosum (Complementation group F; OMIM:133520); xpf-1 is a core NER (Nuclear Excision Repair) factor (other members being xpa-1, xpg-1, and ercc-1); NER factors remove UV-induced DNA damage and have been demonstrated to be required for both the global genome repair (GGR) and transcription coupled repair (TCR) pathways; XPF-1 activity is essential for the survival of germ cells and somatic tissue following UV irradiation and is necessary for germ cells and embryos to survive even relatively low doses of UV irradiation; mutations in xpf-1, as well as the other NER factors, renders animals hypersensitive to UV light; xpf-1(RNAi) animals are also hypersensitive to ultraviolet radiation, with increased germ cell apoptosis and embryonic lethality; XPF-1 protein interacts with ERCC-1 (an ERCC1 ortholog) in yeast two-hybrid assays; xpf-1 is expressed broadly in both embryonic and postembryonic animals, and is required for embryonic development; xpf-1 is upregulated in dauers, and shares an operon with kel-1 and VF13D12L.3.
• Organism: Caenorhabditis elegans
• Automated Description: Enables enzyme binding activity. Involved in DNA damage response; meiotic nuclear division; and regulation of multicellular organismal development. Predicted to be part of nucleotide-excision repair factor 1 complex. Expressed in body wall musculature; embryonic cell; germ cell; and neurons. Used to study Cockayne syndrome; Fanconi anemia; and xeroderma pigmentosum. Human ortholog(s) of this gene implicated in several diseases, including Fanconi anemia complementation group Q; XFE progeroid syndrome; and polyneuropathy due to drug. Is an ortholog of human ERCC4 (ERCC excision repair 4, endonuclease catalytic subunit).
• Biotype: SO:0001217
• Genetic Position: II :3.99161±
• Length (nt): 9201

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00008140

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C47D12.8.1	C47D12.8.1	2899	II: 11696171-11705371
Transcript:C47D12.8.2	C47D12.8.2	2879	II: 11696171-11705351

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C47D12.8	C47D12.8	2808	II: 11696171-11696610

8 RNAi Result

• WBRNAi00042669
• WBRNAi00012071
• WBRNAi00111633
• WBRNAi00036116
• WBRNAi00061508
• WBRNAi00106933
• WBRNAi00062837
• WBRNAi00062836

192 Allele

• gk963801
• gk963053
• gk962684
• gk963539
• WBVar01605131
• WBVar01605132
• WBVar01605133
• WBVar01605134
• WBVar01605135
• WBVar01605136
• WBVar01547173
• WBVar01547172
• WBVar01547174
• h10261
• WBVar02029265
• WBVar02029264
• WBVar02029266
• otn14186
• WBVar01935727
• WBVar01935728
• WBVar01935730
• WBVar01766432
• WBVar01766431
• e1487
• tm2842
• WBVar01380433
• WBVar01440165
• WBVar01440164
• gk942313
• gk942311

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00008140
• Start: 11696171
• End: 11705371
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_11705372..11706008
• Length (nt): 637
• Chromosome Location: II: 11705372-11706008
• Organism: Caenorhabditis elegans

89 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
	Transcripts that showed significantly increased expression in animals exposed to 400uM tamoxifen from L1 to L4 larva stage.	DEseq2, fold change > 2	WBPaper00064505:tamoxifen_upregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_downregulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
Bacteria: B.thuringiensis	Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed altered expression from P0 to F2 generation animals after N2 parental generation were treated with antimycin, but not in damt-1(gk961032) P0 to F2 animals after the parenal generaton were treated with antimycin.	N.A.	WBPaper00055862:antimycin_damt-1(gk961032)_regulated
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background.	DESeq2, FDR < 0.05	WBPaper00060683:hlh-11(ko1)_downregulated
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Transcripts of coding genes that showed significantly increased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_enriched_coding-RNA
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_downregulated
	Germline-intrinsic transcripts.	Comparisons were made between genotypes by subtracting the mean log value of one ratio from another, and the significance of the difference was evaluated using Student t-test for two populations. For the fem-3(gf) versus fem-1(lf) direct comparison, authors performed the same analysis, except they used a Students t-test for one population. Author chose a combination of a twofold difference with a t value exceeding 99% confidence (P < 0.01), because these criteria allowed the inclusion of essentially all genes that had previously been identified as germline-enriched in a wt/glp-4 hermaphrodite comparison. Additionally, requiring a twofold difference reduced false positives, as the number of genes with two-fold difference and a P<0.01 only included ~100 genes more than with P < 0.001, and almost all genes showed germline expression by in situ hybridization.	[cgc6390]:intrinsic
	Transcripts down regulated in hpl-2(tm1489) embryo comparing to N2 in tiling array analysis.	Oligos from the tiling array were mapped to chromosome coordinates of the exons from Wormbase WS180. Any oligo that mapped to a gene on both the Watson and Crick strands was excluded. The remaining oligos were then grouped together (perfect match and mismatch) into probe sets and written out into an Affymetrix CDF file. The CDF file was converted into an R-package and loaded into R. The expression values were calculated using the justRMA function from Bioconductor. This used a Benjamini and Hochberg false discovery rate correction.	WBPaper00040560:hpl-2_embryo_downregulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (FLT) starting at L1 lava stage.	DESeq	WBPaper00053302:alovudine_24h_regulated
20C vs 25C	Transcripts that showed differential expression in 20C vs 25C in N2 animals at adult stage.	N.A.	WBPaper00050488:20C_vs_25C_regulated_N2_adult
	Transcripts that showed significantly depleted expression in sensory neuron (labeled by iaIs25[Pgcy-37::GFP + unc-119(+)]) comparing to in whole worm.	Fold change > 2, p-value < 0.05.	WBPaper00060661:sensory-neuron_depleted

9 Expression Patterns

• Primary Identifier: Expr5529
• Remark: Strain: BC14006
• Reporter Gene: [C47D12.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATACCGCAGCTACAGCTTTGA] 3' and primer B 5' [GTTTCGATCTGAAAAGTTTGCC] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; intestine; Larval Expression: pharyngeal gland cells; intestine

• Primary Identifier: Expr15929
• Pattern: XPF-1 is expressed ubiquitously in nuclei of different tissues, including neurons, muscles, hypodermis, and intestine, as well as germ cells and embryos.

• Primary Identifier: Expr1033534
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2036242
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2018104
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1146656
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1027901
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1702
• Remark: Original chronogram file: chronogram.622.xml
• Reporter Gene: [C47D12.8:gfp] transcriptional fusion.

• Primary Identifier: Expr3076
• Pattern: Expressed in embryo and mixed stage animals. A single form of xpf mRNA was detected at the position of 2.9 kb in total RNA of embryos or total RNA of mixed-stage worms and in purified mRNA as well.

20 GO Annotation

7 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00008140
• Start: 11696171
• End: 11705371
• Strand: 1

20 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in xpf-1(tm2842) comparing to in N2 animals.	DESeq2 1.14.1, fold change > 2, FDR < 0.01.	WBPaper00062497:xpf-1(tm2842)_upregulated
	Transcripts that showed significantly decreased expression in xpf-1(tm2842) comparing to in N2 animals.	DESeq2 1.14.1, fold change > 2, FDR < 0.01.	WBPaper00062497:xpf-1(tm2842)_downregulated

1 Sequence

• Length: 9201

1 Sequence Ontology Term