WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00009580 Gene Name  xbx-6
Sequence Name  ? F40F9.1 Organism  Caenorhabditis elegans
Automated Description  Predicted to be involved in negative regulation of apoptotic signaling pathway. Predicted to be located in Golgi apparatus; endoplasmic reticulum; and membrane. Expressed in neurons; pharyngeal muscle cell; tail; and ventral nerve cord. Is an ortholog of human GRINA (glutamate ionotropic receptor NMDA type subunit associated protein 1). Biotype  SO:0001217
Genetic Position  V :2.08834 ±0.005872 Length (nt)  ? 4781
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00009580

Genomics

6 Transcripts

Class WormMine ID Sequence Name Length (nt) Chromosome Location
NcPrimaryTranscript Transcript:F40F9.1c F40F9.1c 1331   V: 9703055-9707340
MRNA Transcript:F40F9.1a.2 F40F9.1a.2 1252   V: 9703161-9707835
MRNA Transcript:F40F9.1b.2 F40F9.1b.2 1574   V: 9705356-9707773
MRNA Transcript:F40F9.1b.1 F40F9.1b.1 1220   V: 9705356-9707827
MRNA Transcript:F40F9.1a.1 F40F9.1a.1 1189   V: 9705358-9707835
MRNA Transcript:F40F9.1b.3 F40F9.1b.3 1252   V: 9705360-9707831
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F40F9.1a F40F9.1a 891   V: 9705360-9705468
CDS:F40F9.1b F40F9.1b 891   V: 9705360-9705468

11 RNAi Result

WormBase ID
WBRNAi00046882
WBRNAi00046883
WBRNAi00013702
WBRNAi00014668
WBRNAi00014670
WBRNAi00064155
WBRNAi00032040
WBRNAi00062735
WBRNAi00062736
WBRNAi00062737
WBRNAi00062738

75 Allele

Public Name
gk963301
WBVar02060482
gk964351
gk962860
gk963365
gk963364
WBVar01863546
WBVar01863547
WBVar01863544
WBVar01863545
WBVar01863548
WBVar01863549
WBVar01863550
WBVar01863553
WBVar01863554
WBVar01863551
WBVar01863552
WBVar01863555
WBVar01863556
WBVar01863542
WBVar01863543
gk243911
gk243909
gk243910
gk243907
gk243908
gk948764
h4515
gk221
gk780558

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00009580 9703055 9707835 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

0 Downstream Intergenic Region

114 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:pharynx_expressed
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
  Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
  Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals. Sleuth WBPaper00051558:aging_regulated
  Significantly differentially expressed genes as determined by microarray analysis of wild-type and cde-1 mutant germlines. RNAs that changed at least 2-fold with a probability of p < 0.05 were considered differentially regulated between wildtype and cde-1. WBPaper00035269:cde-1_regulated
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. Cufflinks WBPaper00065120:body-muscle-transcriptome
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L2-larva_expressed
  Transcripts that were regulated by both set-6(ok2195) and baz-2(tm0235) at 2-day post L4 adult hermaphrodite stage. N.A. WBPaper00059356:set-6(ok2195)_baz-2(tm0235)_regulated
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:excretory-cell_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_L3-L4-larva_expressed
  Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Gender_Neutral
  Proteins identified in extracellular vesicle. N.A. WBPaper00062669:extracellular-vesicle_protein

9 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC10471 [F40F9.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGCATTTGTCGTAATTCCA] 3' and primer B 5' [TCAACAAGTGAGATAGAAGCAAAA] 3'. Expr6014 Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: anal depressor muscle; hypodermis; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ;  
    Expr3290 Expressed in body wall muscle, commissures, hypodermis, neurons, pharyngeal muscle and ventral nerve cord.  
    Expr1034192 Tiling arrays expression graphs  
    Expr1150748 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2036232 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Promoter::GFP fusion constructs of variable lengths were generated using PCR amplification followed by subsequent cloning into expression vectors.   Expr10142 Expressed in ciliated sensory neurons of the tail. The 60 C. elegans CSNs present in an adult hermaphrodite worm were divided into 5 subgroups or anatomical regions including, neurons that reside in the amphids (region 1 = 24 CSNs: AWAL/R, AWBL/R, AWCL/R, AFDL/R, ASEL/R, ADFL/R, ASGL/R, ASHL/R, ASIL/R, ASJLR, ASKL/R, ADLL/R) or in the tail (region 2 = 5 CSNs: PHAL/R, PHBL/R, PQR), neurons surrounding the anterior bulb (region 3 = 24 CSNs: BAGL/ R, CEPVL/R, CEPDL/R, IL1L/R, IL2L/R, IL1VL/R, IL2VL/R, IL1DL/R, IL2DL/R, OLLL/R, OLQVL/R, OLQDL/R) or the posterior bulb (region 4 = 5 CSNs: ADEL/R, FLPL/R, AQR) of the pharynx, and neurons in the midbody region of the worm (region 5=2 CSNs: PDEL/R). xbx-6 was detected in region 2.  
    Expr1023948 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr3484 xbx-6::gfp is expressed in many different types of cells, including the phasmid neurons PHA and PHB.  
    Expr2018094 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

6 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  located_in
  located_in
  involved_in

11 Homologues

Type
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00009580 9703055 9707835 1

6 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  located_in
  located_in
  located_in
  involved_in

0 Regulates Expr Cluster

1 Sequence

Length
4781

1 Sequence Ontology Term