WormMine: Gene WBGene00011327

• WormBase Gene ID: WBGene00011327
• Gene Name: hlh-34
• Sequence Name: T01D3.2
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA binding activity. Involved in several processes, including nematode pharyngeal pumping; neuron fate specification; and serotonin receptor signaling pathway. Predicted to be located in nucleus. Expressed in ABalapaaap; ABalappapp; AVJL; and AVJR. Human ortholog(s) of this gene implicated in several diseases, including Alzheimer's disease; artery disease (multiple); arthritis (multiple); and kidney cancer (multiple). Is an ortholog of several human genes including NPAS1 (neuronal PAS domain protein 1); SIM1 (SIM bHLH transcription factor 1); and SIM2 (SIM bHLH transcription factor 2).
• Biotype: SO:0001217
• Genetic Position: V :5.58451 ±0.000354
• Length (nt): 1429

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00011327

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T01D3.2.1	T01D3.2.1	1028	V: 13705967-13707395

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T01D3.2	T01D3.2	969	V: 13705986-13706525

5 RNAi Result

• WBRNAi00052123
• WBRNAi00099156
• WBRNAi00017968
• WBRNAi00035018
• WBRNAi00103500

26 Allele

• gk963271
• gk963706
• gk963301
• gk964458
• gk964459
• gk964026
• otn11455
• gk963085
• WBVar01975302
• WBVar01870857
• tm5056
• gk1031
• tm4019
• tm4428
• WBVar02115679
• WBVar01842534
• WBVar01744087
• WBVar01744088
• gk2435
• WBVar01462629
• gk1211
• gk1280
• ok3276
• gk504418
• gk922615
• gk611959

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00011327
• Start: 13705967
• End: 13707395
• Strand: -1

3 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)

0 Downstream Intergenic Region

58 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
Starvation	Transcripts that showed significantly altered expression by starvation with 100 mM salt (NaCl)	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:starvation_regulated_LowSalt
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly increased expression in animals fed with JM103 bacteria producing Cry5B, comparing to control animals fed with JM103.	ANOVA, p-value < 0.05.	WBPaper00056167:Cry5B_upregulated
	Transcripts that showed significantly increased expression in spr-1(ok2144) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:spr-1(ok2144)_upregulated
	Transcripts that showed significantly increased expression in animals after 24 hours of exposure to 300mM NaCl comparing to control animals.	Authors considered genes differentially expressed if they had a q-value <= 0.05 and a b-value >= 1 or <= -1.	WBPaper00053771:up_at_24h-NaCl
	Transcripts that showed significantly increased expression in dpy-7(e88) animals comparing to N2 animals.	Authors considered genes differentially expressed if they had a q-value <= 0.05 and a b-value >= 1 or <= -1.	WBPaper00053771:up_at_dpy-7(e88)
	Top 300 transcripts enriched in ABplaaaaaa, ABarpapaaa, ABplpaaapa, ABprpaaapa according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:URA_parent
	Down-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2.	Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off.	WBPaper00045774:clk-1_downregulated
Bacteria infection: Photorhabdus luminescens	Genes with increased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:P.lumniescens_24hr_upregulated_RNAseq
	Transcripts that showed significantly decreased expression in mter-4(syb3662 syb3403) comparing to in N2.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00061995:mter-4(syb3662syb3403)_downregulated
	Larval Pan-neural Enriched Genes.	A two-class unpaired analysis of the data was performed to identify genes that differ by >= 1.5-fold from the reference at a FDR of <1% for the larval pan-neural, embryonic pan-neural, and larval A-class motor neuron datasets.	WBPaper00030839:Larval_Pan_Neuronal

12 Expression Patterns

• Primary Identifier: Expr6564
• Remark: Strain: BC14542
• Reporter Gene: [T01D3.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAGCAACTTTCTCTTGGAACA] 3' and primer B 5' [TCTCAAGTGGTTATAAGTCAAGCG] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; neurons along body; Larval Expression: intestine; Nervous System; head neurons; neurons along body

• Primary Identifier: Expr6565
• Remark: Strain: BC15839
• Reporter Gene: [T01D3.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAGCAACTTTCTCTTGGAACA] 3' and primer B 5' [TCTCAAGTGGTTATAAGTCAAGCG] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; Larval Expression: Nervous System; head neurons.

• Primary Identifier: Chronogram1869
• Remark: Original chronogram file: chronogram.787.xml
• Reporter Gene: [T01D3.2:gfp] transcriptional fusion.

• Primary Identifier: Expr12171
• Pattern: hlh-34 is expressed in the AVJ pair. Curatorial note: See [Expr15555] for hlh-34 expression in AVH vs AVJ.

• Primary Identifier: Expr15377
• Pattern: Curatorial note: See [Expr15555] for hlh-34 expression in AVH vs AVJ.

• Primary Identifier: Expr1155755
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr15555
• Pattern: Using NeuroPAL, we confirmed sIs14542 expression in AVH, but not AVJ. We further corroborated hlh-34prom expression in AVH by observing that in the embryo, expression of otIs768 is first transiently observed in 4 cells, two of which show signs of cell death; later in embryogenesis, and then during all stages of postembryonic and adult development, expression becomes restricted to 2 cells. This is consistent with expression in the bilateral AVH neuron pair, since their two sisters cells are, unlike the sisters of the AVJ neuron pair, destined to die by apotosis (Sulston et al. 1983).

• Primary Identifier: Expr2012509
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1021720
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2030748
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr12133
• Remark: Reporter gene fusion not specified.
• Pattern: Curatorial note: See [Expr15555] for hlh-34 expression in AVH vs AVJ.

• Primary Identifier: Expr15032
• Pattern: In concurrence with previous work, we confirmed that hlh-34p::GFP was expressed exclusively in the AVJ interneurons. Curatorial note: See [Expr15555] for hlh-34 expression in AVH vs AVJ.

10 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00011327
• Start: 13705967
• End: 13707395
• Strand: -1

10 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1429

1 Sequence Ontology Term