WormMine: Gene WBGene00016265

• WormBase Gene ID: WBGene00016265
• Gene Name: trhr-1
• Sequence Name: C30F12.6
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable thyrotropin-releasing hormone receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Expressed in pm4 and pm5. Human ortholog(s) of this gene implicated in congenital nongoitrous hypothyroidism 7 and hypertension. Is an ortholog of human TRHR (thyrotropin releasing hormone receptor).
• Biotype: SO:0001217
• Genetic Position: I :1.59206 ±0.009201
• Length (nt): 3042

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00016265

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C30F12.6.1	C30F12.6.1	1486	I: 6989067-6992108

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C30F12.6	C30F12.6	1188	I: 6989098-6989286

9 RNAi Result

• WBRNAi00041551
• WBRNAi00072195
• WBRNAi00072832
• WBRNAi00003041
• WBRNAi00029359
• WBRNAi00072833
• WBRNAi00117041
• WBRNAi00110477
• WBRNAi00110476

36 Allele

• gk962858
• gk962706
• gk963902
• WBVar01432017
• gk953149
• gk699167
• gk870723
• gk860866
• gk826699
• gk766942
• gk377955
• gk443926
• gk751150
• gk495130
• gk682084
• gk593696
• gk844618
• gk567178
• gk536046
• gk523161
• gk672346
• gk743294
• gk609444
• gk851376
• gk956347
• WBVar02119845
• WBVar00051707
• gk114066
• gk114067
• gk114068

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00016265
• Start: 6989067
• End: 6992108
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

165 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression at the intestine cells of daf-2(e1370) comparing to the intestine cells of N2 animals at L2 larva stage.	DESeq2 (version 1.24.0), fold change >= 2, FDR < 0.05	WBPaper00064632:daf-2(e1370)_upregulated_intestine
	Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2.	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_N2-background
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:clk-1(qm30)_upregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:mep-1(ne4629)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in npr-15(tm12539) comparing to in N2 at L4 larva stage.	Fold change > 2, FDR < 0.05.	WBPaper00066608:npr-15(tm12539)_upregulated
Bacteria: B.thuringiensis	Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)
Bacteria: B.thuringiensis	Transcripts in N2 animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_N2
	Transcripts that showed altered expression from P0 to F2 generation animals after N2 parental generation were treated with antimycin, but not in damt-1(gk961032) P0 to F2 animals after the parenal generaton were treated with antimycin.	N.A.	WBPaper00055862:antimycin_damt-1(gk961032)_regulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
Heat shock: 35C for 1 hour.	Transcripts that showed significantly increased expression 4 hours after 1-day post L4 adult hermaphrodite N2 animals were exposed to 35C for 1 hour.	The DESeq2 (GalaxyVersion 2.11.40.6 + galaxy1) was used to determine differentiallyexpressed features from count tables of differential transcript abundances. log2FC > 1, FDR < 0.01.	WBPaper00065749:Heat-Shock-With-Recovery_upregulated_N2
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
Bacteria infection: Serratia marcescens	Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:S.marcescens_24hr_upregulated_TilingArray
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Genes that showed significantly decreased expression in wrn-1(gk99) comparing to in N2, according to RNAseq.	DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison.	WBPaper00045934:wrn-1(gk99)_downregulated
	Genes upregulated in dcr-1(-/-) adult animals by at least 1.5 fold and P < 0.01, as determined by a multisample t-test and the Benjamini and Hochberg false discovery rate correction.	Statistical t-test: P < 0.05 for rde-4(-/-) and rde-1(-/-) analyses; P < 0.01 for dcr-1(-/-) analysis with a threshold of 1.5-fold misregulation.	WBPaper00029437:dcr-1_upregulated

8 Expression Patterns

• Primary Identifier: Expr2035633
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5389
• Remark: Strain: BC15771
• Reporter Gene: [C30F12.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTTTTCTTGAGATTCCTTTTCAA] 3' and primer B 5' [TGAGGCTGACGTGATCTTAGAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; Larval Expression: pharynx; intestine

• Primary Identifier: Expr13941
• Pattern: TRHR-1 localized to pharyngeal muscle cells of the metacorpus (pm4) and the isthmus (pm5).

• Primary Identifier: Expr1020039
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram731
• Remark: Original chronogram file: chronogram.1762.xml
• Reporter Gene: [C30F12.6:gfp] transcriptional fusion.

• Primary Identifier: Expr1036960
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2017494
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1145569
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

7 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00016265
• Start: 6989067
• End: 6992108
• Strand: 1

7 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 3042

1 Sequence Ontology Term