WormMine: Gene WBGene00019166

• WormBase Gene ID: WBGene00019166
• Gene Name: tat-2
• Sequence Name: H06H21.10
• Brief Description: tat-2 encodes one of six C. elegans subfamily IV P-type ATPase that, by sequence similarity, is proposed to function as an aminophospholipid translocase (flippase); genetic analyses show that tat-2 has two distinct functions in lipid metabolism: 1) tat-2 is essential for reproductive growth under conditions of sterol deprivation, and 2) TAT-2 activity in the intestine plays a role in regulating monomethyl branched-chain fatty acid-mediated functions during postembryonic growth and development; a tat-2::gfp promoter fusion is expressed beginning at the two-fold stage of embryogenesis and continuing through adulthood with expression detected in pharyngeal cells, the intestine, rectal gland cells, the excretory system, the primary vulval lineages, and the gonad.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable ATPase-coupled intramembrane lipid transporter activity. Involved in sterol metabolic process. Predicted to be located in plasma membrane and trans-Golgi network. Expressed in several structures, including excretory system; gonad; pharynx; rectal gland cell; and vulva. Human ortholog(s) of this gene implicated in benign recurrent intrahepatic cholestasis 1; intrahepatic cholestasis of pregnancy 1; and progressive familial intrahepatic cholestasis 1. Is an ortholog of human ATP8B4 (ATPase phospholipid transporting 8B4 (putative)).
• Biotype: SO:0001217
• Genetic Position: IV :1.35848±
• Length (nt): 19041

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00019166

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:H06H21.10e.1	H06H21.10e.1	4155	IV: 4827853-4846893
Transcript:H06H21.10a.1	H06H21.10a.1	4168	IV: 4827853-4841127
Transcript:H06H21.10f.1	H06H21.10f.1	4273	IV: 4827853-4846893
Transcript:H06H21.10b.1	H06H21.10b.1	4050	IV: 4827853-4841127
Transcript:H06H21.10c.1	H06H21.10c.1	3795	IV: 4828747-4841127
Transcript:H06H21.10d.1	H06H21.10d.1	3900	IV: 4828747-4846893

Other

6 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:H06H21.10a	H06H21.10a	3945	IV: 4828076-4828111
CDS:H06H21.10f	H06H21.10f	4050	IV: 4828076-4828111
CDS:H06H21.10e	H06H21.10e	3918	IV: 4828090-4828111
CDS:H06H21.10c	H06H21.10c	3795	IV: 4828747-4828848
CDS:H06H21.10b	H06H21.10b	3813	IV: 4828090-4828111
CDS:H06H21.10d	H06H21.10d	3900	IV: 4828747-4828848

8 RNAi Result

• WBRNAi00078011
• WBRNAi00049310
• WBRNAi00016205
• WBRNAi00097532
• WBRNAi00092580
• WBRNAi00092587
• WBRNAi00077713
• WBRNAi00099121

262 Allele

• gk964500
• gk963722
• gk963150
• cxTi9097
• gk711735
• WBVar01569001
• tm1773
• WBVar02020557
• gk376655
• WBVar00188824
• WBVar00188825
• WBVar00188826
• WBVar00188827
• WBVar00188828
• WBVar00188829
• WBVar00188820
• WBVar00188821
• WBVar00188822
• WBVar00188823
• WBVar00188830
• WBVar00188817
• WBVar00188818
• WBVar00188819
• WBVar01825776
• h10621
• h8954
• h17623
• WBVar02073346
• tm2332
• tm1634

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00019166
• Start: 4827853
• End: 4846893
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_4827320..4827852
• Length (nt): 533
• Chromosome Location: IV: 4827320-4827852
• Organism: Caenorhabditis elegans

236 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly decreased expression in dissected female germline comparing to in dissected male germline.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:female_vs_male_downregulated
	Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult.	The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak.	WBPaper00044736:oscillating_dev_expression
Growth temperature	Transcripts that are significantly downregulated at 15C compared to both 25C and 20C, with no statistical difference between 25C and 20C, in worms feeding B. subtilis PY79.	DESeq2 and EdgeR, adjusted p-value < 0.05.	WBPaper00053814:15C_downregulated_PY79
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Transcripts that showed significantly increased expression in ubc-9(ne4833[ubc-9(G56R)] in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:ubc-9(ne4833)_upregulated
	Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain.	RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis.	WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
	Transcripts that showed significantly increased expression in wdr-23(mac32) embryos from parents fed with E. coliHB101, comparing to N2 embryos parents fed with E. coli HB101.	DESeq2, Fold Change > 2 or < 0.5.	WBPaper00059566:wdr-23(mac32)_upregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in npr-15(tm12539) comparing to in N2 at L4 larva stage.	Fold change > 2, FDR < 0.05.	WBPaper00066608:npr-15(tm12539)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated

11 Expression Patterns

• Primary Identifier: Expr2035435
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6271
• Remark: Strain: BC13378
• Reporter Gene: [H06H21.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCTGAACCTTGTTCAATTGTGT] 3' and primer B 5' [ACTGAAGATCCCTCCGCC] 3'.
• Pattern: Adult Expression: intestine - posterior cells; Larval Expression: intestine - posterior cells

• Primary Identifier: Expr12797
• Pattern: tat-2 reporter is first clearly detectable in 2-fold stage embryos in two sets of pharyngeal cells, the developing pharyngeal-intestinal valve and a set of cells in the posterior. By the first larval (L1) stage, GFP fluorescence also appears in the intestine. L4 and adult animals exhibit reporter signals in unidentified cells of the pharyngeal procorpus, the gland cells located in the posterior bulb of the pharynx, the pharyngeal-intestinal valve, rectal gland cells, the intestine and all cells of the excretory system. tat-2 reporter signals are also seen in L4 larvae in the primary vulval lineage vulE and vulF cells and in the proximal gonad. The vulval fluorescence vanishes and a moderately strong uterine signal appears after the uterine-vulval connection is complete in adults. The gonadal signal, emanating from spermatids, migrates to the spermatheca around the time of the first ovulation.

• Primary Identifier: Expr10007
• Pattern: The expression of TAT-2 was first detected in first larval stage worms (L1) in the intestine. From the L4 stage on through adulthood, the strongest GFP fluorescence could be detected in the intestine, the excretory canal cell and the spermatheca. However, expression was also seen in the pharyngeal procorpus, the excretory gland cell, the pharyngeal- intestinal valve, and the rectal gland cell. During the L4 stage, the signal was also seen in vulva cells and, around the timing of the first ovulation, it is also expressed in the proximal gonad.

• Primary Identifier: Expr12796
• Pattern: tat-2 is expressed primarily in the excretory cell, spermatheca and intestine.

• Primary Identifier: Expr1153054
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1021622
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1038276
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Chronogram753
• Remark: Original chronogram file: chronogram.1791.xml
• Reporter Gene: [H06H21.10:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1852
• Remark: Original chronogram file: chronogram.771.xml
• Reporter Gene: [H06H21.10:gfp] transcriptional fusion.

• Primary Identifier: Expr2017300
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

21 GO Annotation

18 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00019166
• Start: 4827853
• End: 4846893
• Strand: -1

21 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 19041

1 Sequence Ontology Term