WormMine: Gene WBGene00022434

• WormBase Gene ID: WBGene00022434
• Gene Name: Y108G3AL.2
• Sequence Name: Y108G3AL.2
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to be involved in mRNA splicing, via spliceosome. Predicted to be located in nucleus. Predicted to be part of precatalytic spliceosome. Is an ortholog of human PRPF38B (pre-mRNA processing factor 38B).
• Biotype: SO:0001217
• Genetic Position: :±
• Length (nt): 9837

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00022434

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y108G3AL.2.2	Y108G3AL.2.2	1324	V: 166987-173193
Transcript:Y108G3AL.2.1	Y108G3AL.2.1	1141	V: 166987-176823
Transcript:Y108G3AL.2.4	Y108G3AL.2.4	1222	V: 166987-171582
Transcript:Y108G3AL.2.3	Y108G3AL.2.3	1233	V: 166987-173149

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y108G3AL.2	Y108G3AL.2	984	V: 166993-167133

1 RNAi Result

• WBRNAi00055288

204 Allele

• gk963591
• gk963850
• gk963027
• gk963889
• gk962853
• WBVar01710326
• WBVar01609573
• WBVar01609571
• WBVar01609572
• WBVar02022863
• WBVar02022864
• WBVar00200616
• WBVar00200617
• WBVar00200618
• WBVar00200612
• WBVar00200613
• WBVar00200614
• WBVar00200615
• h15459
• WBVar02071092
• WBVar01985141
• WBVar01985142
• WBVar01985143
• WBVar02031323
• WBVar02031328
• WBVar02031329
• WBVar02031326
• WBVar02031327
• WBVar02031324
• WBVar02031325

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00022434
• Start: 166987
• End: 176823
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_176824..177416
• Length (nt): 593
• Chromosome Location: V: 176824-177416
• Organism: Caenorhabditis elegans

81 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Genes down regulated by mir-243(n4759).	RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243.	WBPaper00036130:mir-243_down_regulated
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background.	DESeq2, FDR < 0.05	WBPaper00060683:hlh-11(ko1)_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_downregulated
	Transcripts that showed significantly increased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2 at early embryo stage.	DESeq2, FDR < 0.05	WBPaper00058691:sin-3(tm1276)_upregulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_upregulated
	Transcripts with significantly increased expression in isp-1(qm150) vs. N2, and in isp-1(qm150) ced-4(n1162) vs. ced-4(n1162).	Comparisons of each genotype were compared to the wild-type using the Empirical Base (Wright & Simon) algorithm and fold changes were represented on a log2 scale. A threshold of p < 0.05 and a fold change of 1.3 (log2) was set to determine differentially expressed targets.	WBPaper00045263:isp-1(qm150)_upregulated
	Transcripts with significantly increased expression in nuo-6(qm200) vs. N2, and in nuo-6(qm200);ced-4(n1162) vs. ced-4(n1162).	Comparisons of each genotype were compared to the wild-type using the Empirical Base (Wright & Simon) algorithm and fold changes were represented on a log2 scale. A threshold of p < 0.05 and a fold change of 1.3 (log2) was set to determine differentially expressed targets.	WBPaper00045263:nuo-6(qm200)_upregulated
20C vs 25C	Transcripts that showed differential expression in 20C vs 25C in mir-34(gk437) animals at adult stage.	N.A.	WBPaper00050488:20C_vs_25C_regulated_mir-34(gk437)_adult
	Transcripts that showed significantly decreased expression in pals-22(jy3) comparing to in N2 at L4 larva stage.	Differential expression analysis was performed in RStudio (v1.1.453) using R (v3.50) and Bioconductor (v3.7) packages. As outlined in the RNAseq123 vignette, data was imported, filtered and normalized using edgeR, and linear modeling and differential expression analysis was performed using limma. An FDR cutoff of <0.01 was used to define differentially expressed genes; no fold-change criteria was used.	WBPaper00056034:pals-22(jy3)_downregulated
	Embryonic class (E): genes that significantly increase in abundance at some point during embryogenesis.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_E
	Transcripts enriched in germline by comparing dissected germline tissue with dissected intestine tissue, both injected with empty RNAi vector.	Genes were determined germline-enriched if the lowest expression value (log2(FPKM+1)) observed in the germline empty vector samples was at least 2-fold higher than the highest expression value observed in the intestine empty vector samples.	WBPaper00051039:germline_enriched
Bacteria infection: Xenorhabdus nematophila	Caenorhabditis elegans Genes with expression levels changed significantly after treatment of Xenorhabdus nematophila.	Differential expression were calculated by empirical eBayes method using eBayes function. P_value <= 0.01 and log2 fold change > 1 were used to call differentially expressed genes in all datasets.	WBPaper00041606:CE_X.nematophila_regulated
	Significantly downregulated genes from cyc-1(RNAi) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:cyc-1(RNAi)_downregulated

7 Expression Patterns

• Primary Identifier: Expr1158824
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1039909
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1015494
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2007005
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram116
• Remark: Original chronogram file: chronogram.1123.xml
• Reporter Gene: [Y108G3AL.2:gfp] transcriptional fusion.

• Primary Identifier: Expr2025228
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6879
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14899
• Reporter Gene: [Y108G3AL.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCGAAGATATTGAGCACGAA] 3' and primer B 5' [TAGTTCTGCGGGAGGAGAAA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: Nervous System; head neurons; amphids; tail neurons; phasmids

8 GO Annotation

5 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00022434
• Start: 166987
• End: 176823
• Strand: 1

8 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 9837

1 Sequence Ontology Term