Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:C17F4.10.1 | C17F4.10.1 |
969
 |
II: 3235956-3237138 |
Other
1 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:C17F4.10 | C17F4.10 |
969
|
II: 3235956-3236210 |
98 Allele
| Public Name |
|---|
| gk964317 |
| gk963801 |
| gk963053 |
| WBVar02122302 |
| WBVar02120456 |
| WBVar02123019 |
| WBVar02122780 |
| WBVar00091191 |
| WBVar02122532 |
| WBVar02124390 |
| WBVar02122098 |
| WBVar02122355 |
| WBVar02124673 |
| WBVar02124872 |
| WBVar02121545 |
| WBVar02120786 |
| WBVar02120617 |
| WBVar02121131 |
| WBVar02123186 |
| WBVar02123659 |
| WBVar02121370 |
| WBVar02122914 |
| WBVar00091066 |
| WBVar02122218 |
| WBVar02121721 |
| gk964209 |
| gk964210 |
| WBVar02124763 |
| WBVar02121950 |
| WBVar02120928 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00023479 | 3235956 | 3237138 | -1 |
3 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrII_3234826..3235955 | 1130 | II: 3234826-3235955 | Caenorhabditis elegans |
10 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. | Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. | WBPaper00045420:fertilization_downregulated_transcript | |
| Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. | DESEQ2, fold change > 2 and FDR < 0.01. | WBPaper00062103:neuron_enriched | |
| Down-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2. | Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off. | WBPaper00045774:clk-1_downregulated | |
| Transcripts that showed significantly decreased expression in mex-1(or286) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. | RPKM fold change > 2. | WBPaper00058598:mex-1(or286)_downregulated | |
| Fungi infection: Drechmeria coniospora | Genes with decreased expression after 12 hours of infection by D.coniospora Fold changes shown are pathogen vs OP50. | For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. | WBPaper00038438:D.coniospora_12hr_downregulated_RNAseq |
| Genes that showed significantly decreased expression level in rsr-2(RNAi) animals comparing to in gfp(RNAi) control. | Fold change > 1.2 or < 0.8. | WBPaper00042477:rsr-2(RNAi)_downregulated_TilingArray | |
| Transcripts that showed significantly increased expression in drh-3(rrr2) comparing to in N2. | edgeR, log2 fold change > 2 or < -2. | WBPaper00053888:drh-3(rrr2)_upregulated | |
| Transcripts that showed significantly increased expression in nfki-1(cer1) animals at L1 larva stage, comparing to in N2 animals. | Differentially expressed genes between wild type and knockouts were explored using DESeq2 R package (v.1.20.0) considering a threshold of adjusted p value < 0.01. | WBPaper00060445:nfki-1(cer1)_upregulated_L1 | |
| Single-cell RNA-Seq cell group 81_0 expressed in neuron. | scVI 0.6.0 | WBPaper00065841:81_0 | |
| Top 300 transcripts enriched in ADLL, ADLR according to single cell RNAseq. | Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. | WBPaper00061340:ADL |
4 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Also expressed in (comments from author) : No comments. Strain: BC16202 | [srz-67::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCGCAGTTACTGTCCCCTTA] 3' and primer B 5' [AGCAATTGATTTCAAACTCGC] 3'. | Expr5286 | Adult Expression: Nervous System; head neurons; Larval Expression: Nervous System; head neurons; | |
| Expr1010851 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr1144861 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr2016912 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). |