WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00019999 Gene Name  srab-14
Sequence Name  ? R10H1.2 Organism  Caenorhabditis elegans
Automated Description  Expressed in ASEL and ASER. Biotype  SO:0001217
Genetic Position  II :0.503485 ±2.6e-05 Length (nt)  ? 2207
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00019999

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:R10H1.2.1 R10H1.2.1 1273   II: 7497284-7499490
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:R10H1.2 R10H1.2 1170   II: 7497372-7497537

3 RNAi Result

WormBase ID
WBRNAi00051735
WBRNAi00017726
WBRNAi00034833

36 Allele

Public Name
gk963801
gk963053
gk962682
gk964310
gk961641
tm12294
WBVar01438480
WBVar01438479
h3984
gk748776
gk834901
gk676455
gk842841
gk347267
gk480370
gk535505
gk416198
gk578130
gk907389
gk541546
gk646062
gk606951
gk449259
gk903496
WBVar01934961
gk147012
gk147011
WBVar00225795
WBVar01251095
ttTi36528

1 Chromosome

WormBase ID Organism Length (nt)
II Caenorhabditis elegans 15279421  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00019999 7497284 7499490 -1

2 Data Sets

Name URL
WormBaseAcedbConverter  
C. elegans genomic annotations (GFF3 Gene)  

0 Downstream Intergenic Region

96 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
  Transcripts that showed significantly decreased expression in adbp-1(qj1) comparing to in N2 animals at L4 larva stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00067079:adbp-1(qj1)_downregulated_L4
  Top 300 transcripts enriched in excretory duct, excretory pore according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:Excretory_duct_and_pore
  Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. Cufflinks WBPaper00065120:body-muscle-transcriptome
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa. DESeq2, FDR <0.05, fold change > 2. WBPaper00059664:srbc-48(ac23)_upregulated
  Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. Student's t-test, fold change > 2, p-value < 0.05. WBPaper00055386:daf-2(e1370)_upregulated
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
Starvation Transcripts that showed significantly altered expression by starvation with 100 mM salt (NaCl) DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:starvation_regulated_LowSalt
  Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Transcripts that showed significantly increased expression in emb-4(hc60) comparing to in N2. DESeq2 WBPaper00052884:emb-4(hc60)_upregulated
Temprature shift to 28C for 48 hours. Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 48 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_48h_upregulated
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) at just prior to the third UVC dose (48h). Genes differentially expressed in control vs after UVC exposure and EtBr treatment at the -1h timepoint (just prior to the third UVC dose (48h)). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_UVC-EtBr-exposed_48h
UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at just prior to the third UVC dose (48h). Genes differentially expressed under EtBr treatment and UVC exposure vs under UVC exposure but without EtBr treatment at the -1h timepoint (just prior to the third UVC dose (48h)). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:UVC-EtBr-exposed_vs_UVC-exposed_48h
  Genes with significant increase of expression in NBAS smgl-1(RNAi) comparing to control. Bioconductor package LIMMA was used to determine differentially expressed genes. The P-values were adjusted for multiple testing with a false-discovery rate (50). Probe sets with fold-change > 1.5 and q-value < 0.05 were used as a cut-off for C. elegans microarrays WBPaper00042561:smgl-1(RNAi)_upregulated
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:excretory-cell_larva_enriched
Bacteria infection: Photorhabdus luminescens Genes with increased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:P.lumniescens_24hr_upregulated_TilingArray
  Transcripts that showed differential expression in dauer N2 vs dauer mir-34(gk437) animals at 20C. N.A. WBPaper00050488:N2_vs_mir-34(gk437)_regulated_dauer_20C
Bacteria diet: complex environmental microbiotas Transcripts that showed significantly decreased expression after L1 larva grew on soil microbiota at 25C for 3 days. N.A. WBPaper00056139:soil-microbiota_downregulated

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2034392 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : No comments. Strain: BC14834 [srab-14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGCGACCTCAGTTTTTGAG] 3' and primer B 5' [TGTTTTGTCTGAAAATTCGGG] 3'. Expr6497 Adult Expression: excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids; Larval Expression: excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids;  
Picture: Figure 2. Reporter gene fusion type not specified.   Expr7918 Expressed in ASE neurons and more than 10 other neurons.  
    Expr1155400 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr2016161 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1014210 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00019999 7497284 7499490 -1

0 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

Length
2207

1 Sequence Ontology Term