WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00016470 Gene Name  srab-5
Sequence Name  ? C36C5.1 Organism  Caenorhabditis elegans
Automated Description  Enriched in anterior distal tip cell based on single-cell RNA-seq studies. Is affected by several genes including clk-1; hlh-26; and ogt-1 based on microarray and RNA-seq studies. Biotype  SO:0000336
Genetic Position  V :-12.721 ±0.002234 Length (nt)  ? 1538
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00016470

Genomics

0 Transcripts

 

Other

0 CDSs

0 RNAi Result

37 Allele

Public Name
gk963301
gk963591
gk963553
gk964259
gk963850
gk963027
gk962689
gk962688
WBVar01972132
WBVar01972131
WBVar00205836
WBVar00205835
WBVar00205839
WBVar00205838
WBVar00205837
WBVar00205842
WBVar00205841
WBVar00205840
gk230213
gk230211
gk230212
WBVar02121467
WBVar02124227
WBVar02123281
gk335234
gk661055
gk551197
gk749085
gk503924
gk662902

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00016470 3179527 3181064 1

2 Data Sets

Name URL
WormBaseAcedbConverter  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_3181065..3184082   3018 V: 3181065-3184082 Caenorhabditis elegans

13 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
  Germline-intrinsic transcripts. Comparisons were made between genotypes by subtracting the mean log value of one ratio from another, and the significance of the difference was evaluated using Student t-test for two populations. For the fem-3(gf) versus fem-1(lf) direct comparison, authors performed the same analysis, except they used a Students t-test for one population. Author chose a combination of a twofold difference with a t value exceeding 99% confidence (P < 0.01), because these criteria allowed the inclusion of essentially all genes that had previously been identified as germline-enriched in a wt/glp-4 hermaphrodite comparison. Additionally, requiring a twofold difference reduced false positives, as the number of genes with two-fold difference and a P<0.01 only included ~100 genes more than with P < 0.001, and almost all genes showed germline expression by in situ hybridization. [cgc6390]:intrinsic
  Down-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2. Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off. WBPaper00045774:clk-1_downregulated
EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at just prior to the third UVC dose (48h). Genes differentially expressed under EtBr treatment without UVC exposure vs after UVC exposure but without EtBr treatment at the -1h timepoint (just prior to the third UVC dose (48h)). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:EtBr-exposed_vs_UVC-exposed_48h
  Transcripts that showed significantly increased expression in eat-2(ad465) comparing to in N2. Student's t-test, fold change > 2, p-value < 0.05. WBPaper00055386:eat-2(ad465)_upregulated
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_9
  Genes in the bottom 10% of expression level across the triplicate L3 samples. To generate the top10 and bottom10 gene sets, authors ranked all genes by mean expression array signal intensity across the three replicates, then took the top and bottom deciles (1,841 genes each) to represent genes with high and low expression. To generate the top10 and bottom10 gene sets, authors ranked all genes by mean expression array signal intensity across the three replicates, then took the top and bottom deciles (1,841 genes each) to represent genes with high and low expression. WBPaper00032528:L3_depleted
  Coexpression clique No. 282, srj-21-srh-32, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:srj-21-srh-32
  Transcripts that showed significantly decreased expression in hlh-26(ok1453) animals exposed to E. faecium for 8 hours, comparing to N2 animals exposed to E. faecium for 8 hours. Fold change > 2. WBPaper00062585:hlh-26(ok1453)_downregulated_E.faecium
  Single-cell RNA-Seq cell group 31_0 expressed in gonad. scVI 0.6.0 WBPaper00065841:31_0

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : ASH, ASI, + ASK amphid neurons. Strong and consistent signal for ASH. ASK and ASI signals are variable and not detectable in some worms (STein Lab 2005). Strain: BC14732 [srab-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACTGAAGTTCCACCCATCG] 3' and primer B 5' [TCTTGATAGGAAGGGATCTGAAAT] 3'. Expr5442 Adult Expression: intestine; anal depressor muscle; Reproductive System; vulval muscle; Nervous System; head neurons; amphids; Larval Expression: intestine; Nervous System; head neurons; amphids;  

0 GO Annotation

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00016470 3179527 3181064 1

0 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

Length
1538

1 Sequence Ontology Term