WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00016497 Gene Name  vps-32.2
Sequence Name  ? C37C3.3 Organism  Caenorhabditis elegans
Automated Description  Enriched in PLM; Y cell; intestine; and sensory neurons based on RNA-seq; single-cell RNA-seq; and microarray studies. Is affected by several genes including etr-1; hsf-1; and hrde-1 based on tiling array; proteomic; microarray; and RNA-seq studies. Is affected by multi-walled carbon nanotube; rifampin; and allantoin based on RNA-seq studies. Biotype  SO:0000336
Genetic Position  V :0.917665 ±0.000744 Length (nt)  ? 1048
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00016497

Genomics

0 Transcripts

 

Other

0 CDSs

0 RNAi Result

15 Allele

Public Name
gk963301
otn8914
gk963553
gk964259
gk964351
gk963850
gk962860
otn12412
WBVar01974381
gk240218
gk359232
gk416036
gk647277
gk735446
gk529826

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00016497 7849984 7851031 1

2 Data Sets

Name URL
WormBaseAcedbConverter  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_7851032..7852279   1248 V: 7851032-7852279 Caenorhabditis elegans

49 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
  Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_upregulated
  Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation). CuffDiff2 WBPaper00051265:F4_hrde-1(tm1200)_upregulated
  Transcripts that showed significantly decreased expression in daf-16(mgDf50) comparing to in N2 at L1 larva stage. DESeq v1.20.0 was used to analyze differential gene expression. Transcripts with adjusted p-value < 0.05 were considered differentialled expressed. WBPaper00048971:daf-16(mgDf50)_downregulated_L1
  Genes which expression is changed in isp-1;ctb-1 mutant and is not affected by developmental klf-1 RNAi, but is brought to wild type levels by klf-1 RNAi in adulthood. N.A. WBPaper00059194:klf-1(RNAi)_regulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:intestine_L2-larva_expressed
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Transcripts of coding genes that showed significantly increased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_enriched_coding-RNA
Bacteria infection: Serratia marcescens Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:S.marcescens_24hr_upregulated_TilingArray
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_downregulated
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Transcripts that showed significantly increased expression in daf-2(e1370) neurons comparing to in N2 neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-2(e1370)_upregulated_neuron
  Transcripts that showed significantly increased expression in daf-16(mu86);daf-2(e1370) neurons comparing to in daf-2(e1370) neurons at day 8adult stage. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:daf-16(mu86)_upregulated_neuron
  Transcripts that showed significantly increased expression in lin-22(ot269) comparing to in N2 at L3 larva. Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1). WBPaper00053295:lin-22(ot269)_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L1-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L2-larva_expressed
Bacteria infection: Serratia marcescens Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:S.marcescens_24hr_upregulated_RNAseq
  Proteins that showed differential expression in (B) let-7(mg279);[let-7 sponge] when comparing to (A) [let-7 sponge], and in (C) gld-1(op236); let-7(mg279);[let-7 sponge] when comparing to (A) [let-7 sponge] N.A. WBPaper00044501:gld-1_let-7_regulated
  Transcripts that showed significantly increased expression in unc-30(ok613) animals at L4 larva stage, comparing to N2 animals. Genes exhibiting at least two-fold change were considered differentially expressed. WBPaper00061439:unc-30(ok613)_upregulated
  Genes expressed in embryonic motor neurons (identified by unc-4::GFP expressing cells). Genes called Present by MAS 5.0 in 2 out of 3 unc-4::GFP hybridizations. WBPaper00025141:unc-4::GFP_Expressed_Genes
Bacteria infection: Photorhabdus luminescens Genes with increased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:P.lumniescens_24hr_upregulated_TilingArray
  Genes enriched in intestine. To identify genes that are significantly enriched by mRNA tagging, we first normalized the total amount of Cy3 and Cy5 signal to each other in each hybridization. We measured the ratio of the signals from the co-immunoprecipitated mRNA (Cy5) to total RNA in the cell extract (Cy3), and calculated the percentile rank for each gene relative to all genes in each hybridization. The mean percentile rank was determined from eight repeats of the mRNA-tagging experiment. Student's t-test was used to determine which genes showed a mean enrichment significantly greater than the median enrichment for all genes (P<0.001). WBPaper00026980:intestine_enriched
  Transcripts that showed significantly increased expression in PLM neuron cells comparing to in whole animal, according to dissected single neuron RNASeq analysis. Fold change >= 4. WBPaper00050344:PLM-neuron_enriched
  Down-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2. Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off. WBPaper00045774:clk-1_downregulated
Bacteria infection: Pseudomonas aeruginosa PA14. 24 hours of exposure. Small RNAs (21-26nt) that showed significantly increased expression after L4 animals were exposed to P .aeruginosa strain PA14 for 24 hours. DESeq2, FDR < 0.05 WBPaper00056868:P.aeruginosa_upregulated_smallRNA

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC15745 [C37C3.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTCTTTCAAAAAGCTACCCA] 3' and primer B 5' [TGATCACCTGATAGGAAAACCA] 3'. Expr5457 Adult Expression: pharynx; pharyngeal-intestinal valve; rectal epithelium; Nervous System; nerve ring; ventral nerve cord; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal epithelium; Nervous System; nerve ring; ventral nerve cord; tail neurons;  
    Expr2036159 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Original chronogram file: chronogram.1658.xml [C37C3.3:gfp] transcriptional fusion. Chronogram629    
    Expr1037074 Tiling arrays expression graphs  
    Expr1011820 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr3595   Diffuse in nerve cords.
    Expr2018022 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1146108 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

0 GO Annotation

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00016497 7849984 7851031 1

0 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

Length
1048

1 Sequence Ontology Term