WormMine: ExpressionPattern Expr5457

• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal epithelium; Nervous System; nerve ring; ventral nerve cord; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal epithelium; Nervous System; nerve ring; ventral nerve cord; tail neurons
• Primary Identifier: Expr5457
• Remark: Strain: BC15745
• Reporter Gene: [C37C3.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTCTTTCAAAAAGCTACCCA] 3' and primer B 5' [TGATCACCTGATAGGAAAACCA] 3'.

7 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine.	pharyngeal-intestinal valve	cardia	WBbt:0005767
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes.	nerve ring	circumpharyngeal nerve ring	WBbt:0006749
epithelium connecting intestine and anus.	rectal epithelium		WBbt:0005800

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00016497	vps-32.2	C37C3.3	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023