WormMine: Gene WBGene00001704

• WormBase Gene ID: WBGene00001704
• Gene Name: grd-15
• Sequence Name: Y87G2A.15
• Brief Description: grd-15 encodes a hedgehog-like protein, with an N-terminal signalsequence and a C-terminal Ground domain; GRD-15 is expressed in amphidsocket cells; the Ground domain is predicted to form acysteine-crosslinked protein involved in intercellular signalling, andit has subtle similarity to the N-terminal Hedge domain of HEDGEHOGproteins; grd-15 has no obvious function in RNAi assays.
• Organism: Caenorhabditis elegans
• Automated Description: Enriched in PHso1L; arc ant V; and excretory system based on single-cell RNA-seq studies. Is affected by several genes including numr-2; numr-1; and atfs-1 based on tiling array; microarray; and RNA-seq studies. Is affected by eleven chemicals including mianserin; Zidovudine; and Psoralens based on RNA-seq studies. Is predicted to encode a protein with the following domain: Ground-like domain.
• Biotype: SO:0001217
• Genetic Position: I :21.4682 ±0.006807
• Length (nt): 1796

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001704

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y87G2A.15.1	Y87G2A.15.1	682	I: 13564567-13566362

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y87G2A.15	Y87G2A.15	630	I: 13564569-13564667

3 RNAi Result

• WBRNAi00077004
• WBRNAi00004845
• WBRNAi00076851

45 Allele

• gk963849
• gk964175
• h11182
• h5229
• gk127343
• gk127339
• gk127340
• gk127341
• gk127342
• gk878482
• gk878483
• gk710981
• gk860930
• gk423995
• gk756548
• gk429592
• gk895945
• gk782130
• gk802136
• gk893827
• gk382257
• gk832657
• gk497485
• gk874558
• gk892591
• gk344964
• WBVar00160990
• WBVar00160991
• WBVar01352756
• WBVar01501890

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001704
• Start: 13564567
• End: 13566362
• Strand: 1

2 Data Sets

• WormBaseAcedbConverter
• C. elegans genomic annotations (GFF3 Gene)

0 Downstream Intergenic Region

81 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts enriched in AMso according to single cell RNAseq.	Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched.	WBPaper00061651:AMso_enriched
	Transcripts enriched in PHso according to single cell RNAseq.	Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched.	WBPaper00061651:PHso_enriched
	Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult.	The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak.	WBPaper00044736:oscillating_dev_expression
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Student's t-test, fold change > 2, p-value < 0.05.	WBPaper00055386:daf-2(e1370)_upregulated
	Transcripts that showed significantly increased expression in pqm-1(ok485) animals after exposure to 5mM CoCl2 for 6hours, comparing to in N2 animals with the same exposure to CoCl2.	Significant differentially-expressed gene sets were identified using one or two-class SAM.	WBPaper00060399:pqm-1(ok485)_upregulated_CoCl2_6hr
	Up-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2.	Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off.	WBPaper00045774:clk-1_upregulated
	Genes that showed significantly decreased expression in wrn-1(gk99) comparing to in N2, according to RNAseq.	DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison.	WBPaper00045934:wrn-1(gk99)_downregulated
	Transcripts that showed significantly decreased expression after animals grew in 500 uM glycine from hatch till 1-day post L4 adult, comparing to untreated animals.	Differential expression was assessed using a nempirical Bayes moderated t-test within limmas linear model framework including the precision weights estimated by voom.Resulting p-values were corrected for multiple testing using the Benjamini-Hochberg false discovery rate. Curator applied threshold: fold change > 2, adjusted p-value < 0.01.	WBPaper00056330:glycine_downregulated
	Transcripts that showed significantly decreased expression in bcf-1(ylf1) comparing to in N2 adult animals.	DESeq2	WBPaper00064933:bcf-1(ylf1)_downregulated_transcript
	Transcripts that showed significantly increased expression in jmjd-3.1p::jmjd-3.1 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:jmjd-3.1(+)_upregulated
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_upregulated
Temprature shift to 28C for 48 hours.	Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 48 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_48h_upregulated
	Transcripts that showed significantly increased expression in dpy-7(e88) animals comparing to N2 animals.	Authors considered genes differentially expressed if they had a q-value <= 0.05 and a b-value >= 1 or <= -1.	WBPaper00053771:up_at_dpy-7(e88)
Bacteria infection: Serratia marcescens	Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:S.marcescens_24hr_upregulated_RNAseq
Acidic Environment: PH 4.33 vs. PH 6.33.	Transcripts that showed significantly increased expression after 3 hours of exposure to acidic environment (PH 4.33), comparing to control animals exposed to PH 6.33 environment.	DESeq2 (1.16.1). The Benjamini and Hochberg's approach was used to adjust the resulting P-values to control the false discovery rate. Corrected value of P < 0.05 and fold change > 2 were set as the threshold for significantly differential expression.	WBPaper00060434:pH4.33_vs_pH6.33_uprgulated
	Genes that increased expression in response to 50uM mianserin on adult day 5, which are not a response to aging. This is a list of 733 genes.	The quasi-likelihood F-test from the edgeR package was used to test these counts for statistically significant differential gene expression between water- and mianserin-treated samples, while controlling for expression differences between the 3 biological replicates. We performed multiple testing correction by using the Benjamini-Hochberg procedure to compute a false discovery rate (FDR) value for each gene, and we considered an FDR less than 10% to be significant.	WBPaper00048926:miaserin_upregulated_adult-day5
	Transcripts enriched in PHsh according to single cell RNAseq.	Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched.	WBPaper00061651:PHsh_enriched
Fungi infection: Harposporium sp.	Genes with decreased expression after 24 hours of infection by Harposporium Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:Harposporium_24hr_downregulated_RNAseq
Bacteria infection: Photorhabdus luminescens	Genes with increased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:P.lumniescens_24hr_upregulated_TilingArray
	Transcripts that showed significantly decreased expression in pry-1(mu38) animals comparing to in N2 at L1 larva stage.	DESeq, FDR < 0.05	WBPaper00055626:pry-1(mu38)_downregulated
	Transcripts that showed significantly increased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_upregulated
Bacteria infection: Photorhabdus luminescens	Genes with increased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:P.lumniescens_24hr_upregulated_RNAseq

7 Expression Patterns

• Primary Identifier: Expr1031018
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1162020
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr7134
• Remark: Also expressed in (comments from author) : detecting a single head cell.. likely an amphid socket cell. Strain: DM13283
• Reporter Gene: [grd-15::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATAACAATCTCGCTATCCTCCA] 3' and primer B 5' [AAGACGGGCGGTTCTTACTTA] 3'.
• Pattern: Adult Expression: amphid socket cells; Larval Expression: amphid socket cells

• Primary Identifier: Expr2012229
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1042
• Remark: Original chronogram file: chronogram.210.xml
• Reporter Gene: [Y87G2A.15:gfp] transcriptional fusion.

• Primary Identifier: Expr1013066
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2030465
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

0 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001704
• Start: 13564567
• End: 13566362
• Strand: 1

0 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1796

1 Sequence Ontology Term