WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Anatomy Term :

Definition  Neuron class of one interneuron, projects along ventral cord to ring. Name  PVT
Primary Identifier  WBbt:0004070 Synonym  lineage name: ABplpappppa

1 Children

Definition Name Synonym Primary Identifier
nucleus of pedigree ABplpappppa ABplpappppa nucleus   WBbt:0002635

4 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Top 300 transcripts enriched in PVT according to single cell RNAseq. Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm. WBPaper00061340:PVT
  Single-cell RNA-Seq cell group 138_0 expressed in neuron. scVI 0.6.0 WBPaper00065841:138_0
  Transcripts enriched in PVT according to single cell RNAseq. Genes that pass the Bonferroni threshold for multiple comparisons (q < 0.05) are significantly enriched. WBPaper00061651:PVT_enriched
  Single-cell RNA-Seq cell group 168 expressed in: PVT. CellRanger, DecontX, Monocle3, Louvain algorithm. WBPaper00065623:168

191 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Picture: 6B, 6C.   Expr4871 GFP expression was observed in PVT. GFP was also detected in the uterine cells close to vulva.  
    Expr4684 GFP expression was detected at most developmental stages, with the spatial expression depending on the developmental stage of the animal. Neuronal expression of hlh-29 was detected in larvae and adults in both amphid and phasmid sockets, in the ALA and PVT neurons, in the chemosensory and mechanosensory neurons, ASI, ASK, PHA, and PQR, and in neurons of the anterior pharyngeal bulb. Weaker expression was also detected in the ASG chemosensory neurons in some transgenic lines. L1 animals show strong expression of hlh-29 in intestinal cells, and weaker expression in the rectal glands and the pharyngeal muscle cell PM1. By L3 stage, intestinal expression of the hlh-29::GFP is limited to the posterior intestinal cells, and PM1 expression is no longer detected. Expression is also detected in the ventral posterior coelomocytes in the later L3-stage larvae, and in the spermatheca and vulval muscles of L4 and adult animals.  
    Expr4244 ser-1::gfp expression was observed in the pharyngeal muscles. In addition, ser-1::gfp expression was observed in the vulval muscles, as well as in many neurons. ser-1::gfp is not detectable in HSN or VC.  
    Expr4445 Expressed in socket cells of IL or OLQ. Expressed in the PVT cell.  
"ASEL biased" incorporates two categories of expression patterns in a given transgenic line: expression only in ASEL in some animals and stronger expression in ASEL than in ASER in other animals.   Expr4532 ASEL biased, AWCL/R (faint), PVT.  
    Expr4525 Expressed in ASER, ASIL/R, PVT, URXL/R, AIYL/R, intestine.  
    Expr4526 Expressed in AWAL/R, ASIL/R, RIAL/R, PVT.  
    Expr4527 Expressed in ASER, ASIL/R, PVT.  
Also expressed in (comments from author) : No comments. Strain: BC14645 [sre-11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAATGGCAATGATGTTTTGC] 3' and primer B 5' [TTTTGTTTGAACCGATTTTTGA] 3'. Expr5245 Adult Expression: intestine; Nervous System; head neurons; PVT interneuron; Larval Expression: intestine; Nervous System; head neurons; PVT interneuron;  
Strain: BC11960 [ced-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTAGGCCTCTCACATTCCTGT] 3' and primer B 5' [TGATGTTTTCGAAACAACGGT] 3'. Expr5438 Adult Expression: intestine; anal sphincter; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; Larval Expression: intestine; anal sphincter; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons;  
Also expressed in (comments from author) : unidentified cells in head and tail, neural. Strain: BC12994 [ubc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGACGATGATATTAGTCCAGAAA] 3' and primer B 5' [TGGGCGTCGTGATATTGAT] 3'. Expr5431 Adult Expression: intestine; hypodermis; seam cells; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; rectal gland cells; hypodermis; seam cells; Nervous System; head neurons; neurons along body; PVT interneuron; tail neurons; unidentified cells in head; unidentified cells in tail ;  
Strain: BC12382 [C35D10.12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTCGTTTGAGCACGCA] 3' and primer B 5' [CCGAACTTATGCTGATACTGTTT] 3'. Expr5433 Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; PVT interneuron; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; PVT interneuron;  
Also expressed in (comments from author) : Embryo incomplete. Strain: BC13252 [let-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAACAGATATGAACGGTGGAATTT] 3' and primer B 5' [TCGTTGCTTCATGGTGGTAG] 3'. Expr5657 Adult Expression: anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; head neurons; PVT interneuron; tail neurons; unidentified cells in tail ; Larval Expression: anal depressor muscle; body wall muscle; Nervous System; head neurons; PVT interneuron; tail neurons; unidentified cells in tail ;  
Also expressed in (comments from author) : Mosaic population Strain: BC15999 [srsx-30::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGGAAAAACTCAAACCTCAAAA] 3' and primer B 5' [CCAAAGATTTCCTGAAAACAACA] 3'. Expr5567 Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; PVT interneuron; tail neurons; unidentified cells in head; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; PVT interneuron; tail neurons; unidentified cells in head;  
Strain: BC12845 [R144.11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCCTTTTTCCTGCTTCCA] 3' and primer B 5' [TTAAAATTACCCCGAAATAAACGA] 3'. Expr6541 Adult Expression: Nervous System; head neurons; neurons along body; PVT interneuron; Larval Expression: intestine; rectal gland cells; Nervous System; head neurons; neurons along body; PVT interneuron;  
Also expressed in (comments from author) : No comments. Strain: BC15614 [R02E12.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TACCCAAGGTGCAAAGGTTC] 3' and primer B 5' [ACGGTGATCCTTAAAGTTGGATT] 3'. Expr6445 Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; PVT interneuron; tail neurons; Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; PVT interneuron; tail neurons;  
Strain: BC10671 [M03F4.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTCACAAGGGACCGTTTTT] 3' and primer B 5' [TTCAACCCACGATAAGAAAATTG] 3'. Expr6415 Adult Expression: intestine; Reproductive System; vulval muscle; Nervous System; nerve ring; tail neurons; Larval Expression: intestine; Nervous System; nerve ring; tail neurons;  
Also expressed in (comments from author) : No comments. Strain: BC14933 [scd-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTAGATAGGTAGGCATTTTGCGT] 3' and primer B 5' [CTTCGTTTACGGATCTTACTGGTT] 3'. Expr6667 Adult Expression: intestine; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; PVT interneuron; tail neurons; phasmids; Larval Expression: intestine; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; PVT interneuron; tail neurons; phasmids;  
Strain: BC15234 [grd-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGGCACATATCCGTCGAT] 3' and primer B 5' [CGTGATCCGAATTGTGACTG] 3'. Expr6706 Adult Expression: Nervous System; head neurons; PVT interneuron; tail neurons; Larval Expression: Nervous System; head neurons; PVT interneuron; tail neurons;  
Also expressed in (comments from author) : No comments. Strain: BC11202 [alh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGCCGAAGTGGATTTTGTTCT] 3' and primer B 5' [GAGAGCTGAACGGAGGATTC] 3'. Expr6177 Adult Expression: pharynx; intestine; rectal gland cells; head mesodermal cell; Nervous System; head neurons; neurons along body; PVT interneuron; Embryo Expression: intestine; Larval Expression: pharynx; intestine; rectal gland cells; head mesodermal cell; Nervous System; head neurons; neurons along body; PVT interneuron;  
Also expressed in (comments from author) : No comments. Strain: BC14926 [cyp-14A3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATTTTATGTTGTCACGTTTTGTC] 3' and primer B 5' [GATTGTGAAACAGCCTTTGTTTT] 3'. Expr6373 Adult Expression: intestine; Larval Expression: intestine; rectal gland cells; Nervous System; head neurons; PVT interneuron; tail neurons;  
Strain: BC14760 [srz-13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GACCGACACCTTACGAGCAT] 3' and primer B 5' [TGTGGAATGTTTATGAGCTTTGA] 3'. Expr6331 Adult Expression: hypodermis; Nervous System; head neurons; PVT interneuron; tail neurons; Larval Expression: intestine; hypodermis; Nervous System; head neurons; PVT interneuron; tail neurons;  
Also expressed in (comments from author) : No comments. Strain: BC15354 [JC8.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGCGCCATATATATCTGAATTA] 3' and primer B 5' [TAATATGTGTAGTTTCGCGTGTCA] 3'. Expr6300 Larval Expression: intestine; Nervous System; ventral nerve cord; head neurons; PVT interneuron;  
Also expressed in (comments from author) : No comments. Strain: BC14699 [sre-30::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTGGCAGAGTCGTGGATTTA] 3' and primer B 5' [TGTGGTCAACATTCAGACAAGA] 3'. Expr6243 Adult Expression: intestine; Nervous System; head neurons; PVT interneuron; tail neurons; Larval Expression: intestine; Nervous System; head neurons; PVT interneuron; tail neurons;  
Picture: N.A. Reporter gene fusion type not specified.   Marker43 PVT cell fate marker.  
Picture: N.A. Reporter gene fusion type not specified.   Marker44 PVT cell fate marker.  
Picture: N.A.   Marker45 PVT cell fate marker.  
Picture: N.A.   Marker46 PVT cell fate marker.  
    Expr14199 ASH, ASI, AWB (dimmer and less consistent), sometimes you see other neurons in the head (variable), PVT  
Also expressed in (comments from author) : No comments. Strain: BC14744 [srab-23::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACAACGAAACTATTAAAACCGCTC] 3' and primer B 5' [TGAAAAGATTTTTGAAATAAGCAA] 3'. Expr6960 Larval Expression: intestine; Nervous System; head neurons; PVT interneuron; tail neurons;  

12 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The whole period of embryogenesis in the nematode Caenorhabditis elegans, from the formation of an egg until hatching. embryo Ce WBls:0000003
  The C. elegans life stage spanning 620-800min(hatch) after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. A stage after elongation is over. The last stage of embryogenesis. Also called pre-hatched embryo, late embryo or morphogenetic embryo. fully-elongated embryo Ce WBls:0000021
  The C. elegans life stage spanning 350-620min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The stage that embryo starts elongation until elongation is over. elongating embryo Ce WBls:0000015
  The C. elegans life stage spanning 290-350min after first cleavage at 20 Centigrade. Proliferate from 421 cells to 560 cells. The stage when embryo just finished gastrulation and is enclosing. enclosing embryo Ce WBls:0000013
  The C. elegans life stage spanning 100-290min after first cleavage at 20 Centigrade. Proliferate from 28 cells to 421 cells. Referring to the whole period of gastrulation. gastrulating embryo Ce WBls:0000010
  The C. elegans life stage spanning 0-350min after first cleavage at 20 Centigrade. Proliferate from 1 cell to 560 cells. From start of first cleavage until cleavage is over. proliferating embryo Ce WBls:0000004
  The C. elegans life stage spanning 390-420min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo looks like a comma. A stage between bean embryo and 1.5-fold embryo. comma embryo Ce WBls:0000017
  The C. elegans life stage spanning 460-520min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and double fold. A stage between 1.5-fold embryo and 3-fold embryo. 2-fold embryo Ce WBls:0000019
  The C. elegans life stage spanning 520-620min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and tripple fold. A stage between 2-fold embryo and fully-elongated embryo. Also called pretzel embryo or pretzel stage. 3-fold embryo Ce WBls:0000020
  The C. elegans life stage spanning 420-460min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. The shape of embryo is elongated and fold back 50%. A stage between comma embryo and 2-fold embryo. 1.5-fold embryo Ce WBls:0000018
  The C. elegans life stage spanning 350-390min after first cleavage at 20 Centigrade. Cell number remains at ~560 cells, with some new cells generated and some cells go through programmed cell death. Emrbyo elongation started but have not formed comma shape yet. The shape of embryo looks like a lima bean. A stage right before comma embryo. Also called lima embryo or lima bean stage. bean embryo Ce WBls:0000016
  The C. elegans life stage spanning 210-350min after first cleavage at 20 Centigrade. Proliferate from 421 cells to 560 cells. The stage before the fast cleavage of cells finishes. late cleavage stage embryo Ce WBls:0000014

4 Parents

Definition Name Synonym Primary Identifier
  interneuron   WBbt:0005113
neuron with cell body in the preanal ganglion. preanal ganglion neuron preanal ganglion neurons WBbt:0005447
neuron that has neural processes in the nerve ring. nerve ring neuron   WBbt:0006974
embryonic cell ABplpapppp   WBbt:0006019