WormMine: AnatomyTerm WBbt:0005448

• Definition: ganglion anterior to the anus.
• Name: preanal ganglion
• Primary Identifier: WBbt:0005448

1 Children

Definition	Name	Synonym	Primary Identifier
neuron with cell body in the preanal ganglion.	preanal ganglion neuron	preanal ganglion neurons	WBbt:0005447

0 Expression Clusters

40 Expression Patterns

• Primary Identifier: Expr4900
• Remark: Picture: Figure 4.
• Pattern: UNC-69::GFP expression was first detectable in embryos. In immature neurons, UNC-69::GFP expressed in the processes and growth cones of developing neurites. In older larvae and adults, UNC-69::GFP was expressed in neurons of the anterior, lateral, ventral and retro-vesicular ganglia in the head, and in neurons of the preanal, dorso-rectal and lumbar ganglia in the tail. The fusion protein was also present in the ventral nerve cord (VNC), in the dorsal nerve cord (DNC), in the dorsal and ventral sublateral nerve cords, and in commissural axons. The reporter was expressed in the neurons named CAN, HSN, ALM, PLM, AVM, PVM, BDU, and SDQR, as evidenced by its localization to the cell bodies of these neurons. Expression of unc-69 in these latter cells was confirmed using an unc-69::LacZ::NLS fusion.
• Subcellular Localization: In immature neurons, UNC-69::GFP expressed in the processes and growth cones of developing neurites. In older larvae and adults, UNC-69::GFP was expressed in the cell bodies of neurons.

• Primary Identifier: Expr15024
• Pattern: Consistent with the previous report on the hermaphrodites' expression, we confirmed here that for both sexes, all three of pck-1-expressing reporters express in head and body wall muscles. However, we found that the reporters also express in ventral cord and preanal neurons and nerve ring neurons per side in the head. In the tail region, both larval males and larval/adult hermaphrodites express the transgenes in the dorsal rectal ganglion and three neurons per side in the tail. The adult male shows additional expression in sex-specific neurons of the ray, postcloacal, and spicule sensilla. None of the constructs promote expression in male or hermaphrodite sex muscles, intestine, or pharyngeal muscles.

• Primary Identifier: Expr11583
• Pattern: Paakg-5::GFP is expressed in the female gonad sheath cells, vulva epithelium and neurons, ventral cord neurons and excretory cell. It is also seen in the spermatheca and epithelial seam cells. In addition to the excretory cell, Paakg-5::GFP displays strong expression levels in the pharyngeal epithelia, neurons, some ring neurons and sensory neuron termini. In the tail, Paakg- 5::GFP signal mostly localizes to the pre-anal ganglion, rectum epithelium, intestinal-rectal valve and phasmid support cells. For a summary of Paakg-5::GFP see table S10.

• Primary Identifier: Expr2667
• Pattern: Immunoreactive ICD-1 is first detected as early as the two-cell stage and continues to be expressed widely throughout the lifespan of C. elegans. In post-embryonic development and adulthood, it is particularly highly expressed in the nerve ring and pre-anal ganglion, as well as in intestinal and germ cells of both hermaphrodites and males. The ventral nerve cord, epidermis and muscles contain smaller amounts of ICD-1, and expression in other cells (such as in the pharynx) is relatively weak.
• Subcellular Localization: Beginning early in embryogenesis, ICD-1 is present in a web-like and punctuate pattern in the cytoplasm, coincident with the pattern detected by MitoTracker Red, a marker of mitochondria.

• Primary Identifier: Expr3209
• Pattern: Expression of the UNC-116::GFP and KLC-2::GFP fusion proteins was seen broadly in multiple tissues including most of the neurons, muscles, and pharynx.
• Subcellular Localization: The GFP expression within a given cell was in general diffuse and excluded from the nucleus.

• Primary Identifier: Expr652
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: beta-gal detected from late embryogenesis to adulthood. L1 expression restricted to gut cells (intestinal cells). L2-adult staining in gut, muscle, hypodermis, other epithelial cells, vulval cell and the nervous system (ganglia in the head and tail region and ventral nerve cord)

• Primary Identifier: Expr12148
• Pattern: mtm-6 is expressed in many neurons throughout the worm, the pre-anal ganglion, hypodermal cells, the anal depressor muscle, and additional non-neuronal of cells in the tail. The expression pattern is fairly constant through development.

• Primary Identifier: Expr122
• Remark: Other strain-- UL403 late embryo(author) = elongating embryo + fully-elongated embryo(curator).
• Pattern: Expression begins in precomma stage embryos. It is quite strong, with extensive diffuse cytoplasmic staining as well as nuclear localised staining. Expression is strongest in young larvae, with staining observed in the ventral nerve cord, the circumpharyngeal nerve ring, the head ganglion, the tail ganglion, the retrovesicular ganglion, and in the developing vulva. In older larvae and in adults the strong pharyngeal expression seen in young larvae is less intense and some neuronal processes in the head become apparent (e.g. the motorneuron M1). There is also staining in the pharyngo-intestinal valve and in the seam cells, though expression appears to exclude the nuclei and is generally intermittent along the seam. The defecation muscle group stain as does its axon, DVB. The dorsal cord also stains but is very faint. Two commissures stain (these are also faint), one is located anterior to the vulva, and the other is posterior to the vulva.

• Primary Identifier: Expr13611
• Remark: Strain UL2572
• Pattern: Faint larval and adult expression in pharynx. In larvae, expression also in a tail structure that could be the pre-anal ganglion. Widespread nuclear-localized expression begins in comma stage embryos.

• Primary Identifier: Expr14024
• Pattern: Several head neurons, I1 or I2 pharyngeal neurons, head mesodermal cell?, pharynx, vulva, CAN, VC, DA9, 1 neuron pair in the tail, PVT, another cell in PAG?

• Primary Identifier: Expr10030
• Pattern: rsbp-1 transgene was expressed in head and tail neurons and motor neurons of the ventral cord that innervate body-wall muscle cells. Expression was also observed in vulval, pharyngeal, and body-wall muscle cells. The rsbp-1p::GFP transgene was expressed in many ventral cord motor neurons. We consistently found rsbp-1p::GFP expression in ventral cord neurons between the retrovesicular ganglia and pre-anal ganglia indicating that RSBP-1 was expressed in both cholinergic and GABAergic motor neurons.

• Primary Identifier: Expr7838
• Remark: Picture: Figure 4.
• Pattern: UNC-69::GFP expression was first detectable in embryos. In older larvae and adults, UNC-69::GFP was expressed in neurons of the anterior, lateral, ventral and retro-vesicular ganglia in the head, and in neurons of the preanal, dorso-rectal and lumbar ganglia in the tail. The fusion protein was also present in the ventral nerve cord (VNC), in the dorsal nerve cord (DNC), in the dorsal and ventral sublateral nerve cords, and in commissural axons. The reporter was expressed in the neurons named CAN, HSN, ALM, PLM, AVM, PVM, BDU, and SDQR, as evidenced by its localization to the cell bodies of these neurons. Expression of unc-69 in these latter cells was confirmed using an unc-69::LacZ::NLS fusion. Taken together, these results indicate that unc-69 is expressed widely, perhaps ubiquitously, in the C. elegans nervous system.
• Subcellular Localization: In immature neurons, UNC-69::GFP expressed in the processes and growth cones of developing neurites.

• Primary Identifier: Expr50
• Remark: Fusion junction ...AGCTCTCCAACGATGTACGAGAGAAGGATGCTGGGAAGGTCGTGGAAGTGTTGAAAGTCACGACCACGG TCAATAGATTATGTAGAGGATTCCCTACGTCACGAGTATCTAGATGGATTGCAAGGGGAAGAGGACGCACTG GCAAAGATC/lacZ. Legacy Data: Author "Arnold JM" "Krupa AP" "Hope IA". Date 1992-01. Young and Hope (1993). Dev. Dynam. 196:124-132 = [cgc1752]
• Pattern: b-galactosidase expression in areas of all the major ganglia (lateral, ventral, retrovesicular, pre-anal and dorso-rectal), along the ventral nerve cord, occasionally in the spermathecal valves and in the vulva. Expression appears to be nuclear-localized, although cell bodies and neural processes in the ventral nerve cord also show staining. The pattern is first visualized as a stripe of staining following the curve of the elongating embryo, possibly corresponding to the embryonic ventral nerve cord which consists of the DA, DB and DD motorneurones

• Primary Identifier: Expr112
• Remark: Other strain-- UL481. Legacy Data: "Bauer PK" "Mounsey A" "McCarroll D" "Hope IA"Date 1998-12. late embryo(author) = 3-fold embryo(curator).
• Pattern: This neuronal pattern gives expression throughout all life stages of C. elegans. Staining is first seen in precomma stage embryos. In 3-fold embryos expression appears to be localised in nuclei around the pharynx and tail. In young larvae there is extensive staining in all of the head ganglia and the anal ganglion. The ventral nerve cord and its cell bodies also show strong expression. As the worm ages the expression in the head ganglia is reduced to a number of nuclei in the ventral (ie AIML/R?) and lateral ganglion, although expression in the nerve ring and the ventral nerve cord is still observed. There appears to be some mosaicism in the expression as some larvae show stronger staining in the ventral nerve cord and more nuclei stain in the head ganglia, whereas in other larvae head expression is reduced and only the cell bodies of the ventral nerve cord stain. Diffuse expression is sometimes observed in the metacorpus and terminal bulb of the pharynx in larvae and adults.

• Primary Identifier: Expr1458
• Pattern: In transgenic animals carrying the fusion gene, an egl-19::GFP fluorescent signal was first detected in body wall muscles in 11/2-fold embryos, before the onset of embryonic muscle contraction. By the time of hatching, GFP fluorescence was found in pharyngeal muscles pm3, pm4, pm5 and pm7, in body wall muscles and in the anal depressor muscle. Expression was also found in the nervous system, including the pharyngeal neuron M4 and several neurons in the head, the ventral nerve cord and the preanal ganglion.

• Primary Identifier: Expr1919
• Pattern: Expressed in two ALN, two PLN, two PVP, two PVQ, two BDU, two PVM, excretory cell, four VulC cells, two PDE socket cells.

• Primary Identifier: Expr2378
• Remark: Immunostaining increased in neuronal cell bodies of unc-104 KIF1A mutants, whereas staining in axons was proportionately diminished. In addition, a broader expression pattern was observed in unc-104 KIF1A mutants compared with wild-type controls, because retention in the cell bodies enabled identification of previously undetected neurons.
• Pattern: Immunostaining in wild-type animals showed that EGL-21::GFP is expressed widely in the nervous system, with particularly strong expression in the neuronal processes of the nerve ring. EGL-21::GFP was not expressed in any non-neuronal tissues. egl-21 immunostaining was found in ~100 cells in the head and several neurons in the tail ganglia (15+/-3) and pre-anal ganglion (7+/-1) and motor neurons of the ventral cord (38+/-4). The subset of the egl-21 CPE-expressing cells include the following: the mechanosensory neurons ALM, AVM, and PVM; the interneurons BDU, SDQ; and the HSN egg-laying motor neurons.
• Subcellular Localization: In wild-type animals, egl-21 immunostaining was most concentrated in the nerve ring and other neuronal processes, whereas neuronal cell bodies had lower levels of expression.

• Primary Identifier: Expr949
• Pattern: gfp is expressed in a variety of cells, including the HSNs; hyp 8, 9, and 10; B; F; rect D; DVC; some ventral cord neurons; cells in the head; and cells in the preanal ganglion. sem-4 gfp is expressed in the VPCs. Expression in the VPCs is first observable during L2 and persists in the vulval lineages until the vulval divisions are complete. Expression is undetectable again by the mid-L4 stage, before vulval morphogenesis has terminated. Expression of sem-4 gfp in vulval cells is often strongest in the descendants of P7.p.

• Primary Identifier: Expr13769
• Subcellular Localization: CLR-1/RPTP was localized throughout the AVA axon, but was brightest in the preanal ganglion, where AVA neurons contact PHB neurons. Interestingly, within the region of the preanal ganglion, it was usually concentrated in the anterior half, where the majority of synapses between PHB and AVA normally form.

• Primary Identifier: Expr1918
• Pattern: In the pAB::GFP fusion, expression was seen in some pioneering neurones of the nerve ring, beginning at the early comma stage. At the two-fold stage, expression was detected in some 10 neurones in the head that extend axons into the nerve ring, and in two neurones in the tail that extend processes anteriorly. This expression pattern was confirmed by immunohistochemistry with MAb 16-48-2. At the three-fold stage, expression was seen in all DA motoneurones and persisted while they pioneered the dorsal nerve chord. It was also seen in four to six neurones in each of the four head ganglia, including ALA and RID in the dorsal ganglion, and four of the six neurones of the terminal bulb, including M5. In the tail, two neurones in the pre-anal ganglion and six in the lumbar ganglion, including PVQL and PVQR, showed pAB::GFP expression. Additionally, a transient expression was seen in the four rows of bodywall muscle cells in the embryo. After hatching, in L1 larvae, the expression domain extended to amphid and phasmid socket cells, and subsequently in L2 larvae to all the newly born AS motoneurones. In hermaphrodite L3 larvae, expression was seen in the sex myoblasts subsequent to their anterior migration towards the position of the presumptive vulva, and in adult worms at a high level in the vulval muscles vm1 and vm2. In males, expression was seen in the diagonal and spicule retractor muscles.

• Primary Identifier: Expr8536
• Remark: Picture: Fig. 2A,B.
• Subcellular Localization: The commissures of all inhibitory motor neurons, including their characteristic branches in the sublateral nerve cords, were strongly stained; often the cell bodies of the inhibitory motor neurons were also stained. In the head ganglia there was staining of the same neurons that had previously been found to contain GLI -namely, four neurons in the nerve ring (the RME-like cells)-and staining of three or four more pairs of cells in the ventral and lateral ganglia. In the tail ganglia, two neurons were stained (the DVB-like cell and a neuron in the preanal ganglion).

• Primary Identifier: Expr3158
• Pattern: The mau-2 transcript is abundant in the embryonic and young adulthood stages, whereas it is present in low amounts throughout the larval stages.

• Primary Identifier: Expr877
• Remark: A C-terminal GFP fusion (EGL-44::GFP) fluoresced in pharyngeal muscle cells and some intestinal nuclei. Because this reporter did not rescue the Egl phenotype, it may not reflect accurately the egl-44 expression pattern. A free C terminus may be important for function, because an N-terminal protein fusion (GFP::EGL-44) partially rescued the Egl phenotype, and authors believe the pattern of fluorescence is more likely to represent the true expression pattern of the gene.
• Pattern: GFP was detected in various nuclei starting from before gastrulation through adulthood. Newly hatched larvae expressed GFP in nuclei of the hypodermis (hyp3, hyp4, hyp6, and hyp7), intestine, pharyngeal muscle cells, and neurons (in the head and in the ventral, retrovesicular, preanal, and lumbar ganglia). In the second larval stage (L2), more hypodermal nuclei fluoresced in the body and the tail. In adults, GFP fluorescence was much fainter in the hypodermal cells and no longer delectable in some neurons in the head and tail. Other neuronal expression and the intestinal expression remained. GFP::EGL-44 was expressed in two cell types, the FLP and HSN cells, whose cell fate is altered in egl-44 mutants. The fluorescence in the FLP cells was maintained from the L1 larval stage through adulthood. In contrast to the FLP cells, which expressed the fusion postembryonically, the HSN neurons fluoresced only embryonically, at the 1.5-fold stage. Authors confirmed the identity of these embryonic HSN cells by noting the absence of this fluorescence in egl-1(n487) mutants, animals in which the HSN neurons die at this time. GFP::EGL-44 expression was not seen in the touch cells.
• Subcellular Localization: nuclei.

• Primary Identifier: Expr1778
• Pattern: The UNC-16::GFP fusion protein was expressed in neurons of the ventral cord, retrovesicular and preanal ganglia, and nerve ring, as well as intestinal cells, seam and hypodermal cells, body wall and head muscle, and pharynx.
• Subcellular Localization: Within many neurons, UNC-16::GFP was excluded from the nucleus and diffusely localized throughout the cell body and neuronal processes. More intense localization was seen in regions adjacent to the nucleus and at presumptive tips of the neuronal processes.

• Primary Identifier: Expr2246
• Pattern: In general, the expression patterns found for the translational fusion constructs were similar to those reported above for the transcriptional fusions. Cells were labeled in the anterior, lateral and ventral, and retrovesicular ganglion near the pharynx, in the ventral nerve cord, and in the pre-anal, dorso-rectal, and lumbar ganglion near the tail. Animals demonstrated labeling of the lumbar ganglion in an adult animal. HSN (hermaphrodite-specific neuron) was also labeled as were the vulC cells of the vulva and the excretory cell.
• Subcellular Localization: NHX-5 appeared to be associated with intracellular membranes. NHX-5::GFP expression occurred primarily in neuronal cell bodies. Labeling was granular in the cytoplasm and extended weakly through the neuronal cell processes.

• Primary Identifier: Expr543
• Remark: Transgenic Marker: rol-6(su1006).
• Pattern: Expressed in ventral nerve cord, nerve ring, preanal ganglion, body wall muscle cells, pharyngeal muscles, anal muscles, vulval muscles; intestinal cells in adult.

• Primary Identifier: Expr649
• Remark: This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope).
• Pattern: beta-gal expression was seen throughout all developmental stages and in many tissues: intestine, muscle (probably body wall muscle), hypodermis, other epithelial cells, head and tail ganglia.

• Primary Identifier: Expr1094
• Pattern: The lacZ fusion expressed in pharyngeal muscles, uterine endothelial cells, intestine and neurons in the ring ganglia, the ventral ganglion and ganglia around the anus, as well as in embryos. A gfp fusion gene showed similar expression patterns.

• Primary Identifier: Expr2420
• Pattern: The LIS-1::GFP fusion was observed in all major neural processes: the ventral nerve cord as well as dorsal and lateral cords and connecting commissures. Expression was noted in the region of the nerve ring and the preanal ganglion. Young adult stages showed strong expression, in particular non-neural cells including the spermathecal valve and the seam cell syncytium, as well as weaker fluorescence in the uterine wall, hypodermal and intestinal cells.
• Subcellular Localization: neuronal processes

• Primary Identifier: Expr11586
• Pattern: Paakg-4::gfp is broadly expressed in C. elegans. Paakg-4::gfp is seen in tail sensory organs: phasmid sheath, socket cells and neurons, as well as in epithelial rectal cells, anal-depressor muscle, pre-anal ganglion rectal neurons, body wall muscles, posterior intestine and dorsal cord neuronal processes. Paakg-4::gfp is expressed in vulval, uterine muscles and ventral cord processes. Head expression mostly localizes to the ring ganglia plus 6 pharyngeal neurons. It is also seen in amphid sensory organs including sheath, socket cells and neurons. For a summary of Paakg-4::gfp see table S10.

0 Life Stages

1 Parents

Definition	Name	Synonym	Primary Identifier
ganglion in the trunk of the body.	body ganglion		WBbt:0005332