WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: intestine; stomato-intestinal muscle; Reproductive System; vulval muscle; coelomocytes; Nervous System; ventral nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: intestine; stomato-intestinal muscle; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons; Primary Identifier  Expr5381
Remark  Strain: BC14421 Reporter Gene  [C29H12.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAATGGAAATTGTCGACTGCT] 3' and primer B 5' [GCCACGATCTTGTCTGAAACTAT] 3'.

12 Anatomy Terms

Definition Name Synonym Primary Identifier
neuron with cell body associated with the ventral nerve cord. ventral cord neuron ventral cord motoneuron WBbt:0005300
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages. intestine gut WBbt:0005772
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses. neuron neurone WBbt:0003679
A free-floating spherical cell lying in the pseudocoelomic cavity of larvae and adult C. elegans which can endocytose many compounds, possibly for immune surveillance. There are six coelomocytes in adult hermaphrodites, and they display prominent cytoplasmic inclusions and vacuoles. coelomocyte   WBbt:0005751
nerve cord positioned at the lateral flanks of the animal, consists of processes of the neuron classes BDU, CAN, PVD and ALA. lateral nerve cord   WBbt:0006769
  reproductive system   WBbt:0005747
left intestinal muscle cell, attach to intestine and body wall anterior to anus mu_int_L lineage name: ABplpppppaa WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus mu_int_R lineage name: MSppaapp WBbt:0003822

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00016235 C29H12.2 C29H12.2 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023