WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; excretory gland cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; anal depressor muscle; anal sphincter; rectal epithelium; Reproductive System; distal tip cell; developing gonad; developing vulva; developing uterus; uterine-seam cell; developing spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory gland cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; Primary Identifier  Expr5944
Remark  Also expressed in (comments from author) : Mosaic population.Hypodermis: only in the tail.Coelomocytes: saw the 4 ventral cells. Strain: BC14222 Reporter Gene  [F33H2.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACATAATCGATAGACTCCCAGC] 3' and primer B 5' [TAGACGGGATGATTGAGGATG] 3'.

29 Anatomy Terms

Definition Name Synonym Primary Identifier
neuron with cell body associated with the ventral nerve cord. ventral cord neuron ventral cord motoneuron WBbt:0005300
an accordion-like tube that contains sperm and is the site of oocyte fertilization. spermatheca   WBbt:0005319
female genital. vulva   WBbt:0006748
A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine. pharyngeal-intestinal valve cardia WBbt:0005767
Epidermal layer. hypodermis epidermis WBbt:0005733
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
Anterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad anterior distal tip cell gon herm dtc A WBbt:0004520
Posterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad posterior distal tip cell gon herm dtc P WBbt:0004506
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents. anal depressor muscle dilator muscle WBbt:0004292
The organ in which the eggs are developed and protected until laid. uterus   WBbt:0006760
gland cell of the secretory-excretory system, sends processes to ring, opens into excretory duct. excretory gland cell exc gl WBbt:0005776
a saddle-shaped muscle cell that encircles the intestinal-rectal valve anal sphincter muscle lineage name: ABprpppppap WBbt:0005798
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses. neuron neurone WBbt:0003679
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes. nerve ring circumpharyngeal nerve ring WBbt:0006749
A free-floating spherical cell lying in the pseudocoelomic cavity of larvae and adult C. elegans which can endocytose many compounds, possibly for immune surveillance. There are six coelomocytes in adult hermaphrodites, and they display prominent cytoplasmic inclusions and vacuoles. coelomocyte   WBbt:0005751
a bundle of nerve processes that runs along the dorsal mid-line of the animal. dorsal nerve cord dorsal cord WBbt:0006750
muscle lining of the uterine wall. uterine muscle   WBbt:0005342
five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis. gonadal sheath cell   WBbt:0005828
membranous cell attaches the uterus to the lateral epidermis (seam) and forms a thin laminar process dorsal to the vulva. formed by fusion of eight pi cell progeny and AC. uterine seam cell utse WBbt:0006789
organ producing either sperm or ova. gonad   WBbt:0005175
nerve cord positioned at the lateral flanks of the animal, consists of processes of the neuron classes BDU, CAN, PVD and ALA. lateral nerve cord   WBbt:0006769
epithelium connecting intestine and anus. rectal epithelium   WBbt:0005800
  reproductive system   WBbt:0005747
left intestinal muscle cell, attach to intestine and body wall anterior to anus mu_int_L lineage name: ABplpppppaa WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus mu_int_R lineage name: MSppaapp WBbt:0003822

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00009367 F33H2.3 F33H2.3 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023