WormMine: AnatomyTerm WBbt:0005800

• Definition: epithelium connecting intestine and anus.
• Name: rectal epithelium
• Primary Identifier: WBbt:0005800

6 Children

Definition	Name	Synonym	Primary Identifier
Rectal cell, blast cell in male	F cell	lineage name: ABplppppapp	WBbt:0004799
Rectal cell, postembryonic blast cell in male	U cell	lineage name: ABplppppapa	WBbt:0004942
Rectal cell	K' cell	lineage name: ABplpapppap	WBbt:0004497
Rectal cell at hatching, becomes PDA in hermaphrodite, postembryonic blast cell in male	Y cell	lineage name: ABprpppaaaa	WBbt:0004578
Rectal cell	K.a	lineage name: K.a	WBbt:0004495
a rectal epithelial cell in hermaphrodite.	B cell hermaphrodite	lineage name: ABprppppapa	WBbt:0008063

0 Expression Clusters

202 Expression Patterns

• Primary Identifier: Expr4344
• Pattern: qua-1pro::GFP was found to be expressed in the hypodermal cells covering the whole body from the tip of the nose to the tip of the tail spike, but not in the lateral hypodermal cells, i.e., the seam cells. Furthermore, expression was seen in the excretory duct and pore cells from threefold stage embryos to adults. However, in adults the GFP intensity appears weaker than in larvae. In L1 larvae, qua-1 is expressed in two, sometimes four, cells of the anterior as well as the posterior of the intestine and a rectal epithelial cell. In addition, transient expression was observed in the P cells in L1 in the ventral side of the animal and in a few sensilla support cells in the head. In adults, qua-1pro::GFP is transiently expressed in a few cells in the head that remain to be identified.

• Primary Identifier: Expr4436
• Pattern: Expressed in the rectal epithelial cells from L1 and maintained through adulthood. Expressed in VulC.

• Primary Identifier: Expr4437
• Pattern: Expressed in the seam cells from L1 to adult. Expressed in the rectal epithelial cells from L1 and maintain through adulthood. Expressed in the pro- and metacorpus and isthmus.

• Primary Identifier: Expr4438
• Pattern: Expressed in the hypodermis in larval and adult stages. Expressed in the seam cells at adult stage. Expressed in the rectal epithelial cells from L1 and maintain through adulthood.

• Primary Identifier: Expr4431
• Pattern: Expressed in the seam cells at adult stage. Expressed in the rectal epithelial cells only in the fourth larval stage (L4). Expressed in VulB and VulD. Expressed in anterior arcade cells. Expressed in a pharyngeal neuron in the metacorpus extending a neurite anteriorly and an axon posteriorly.

• Primary Identifier: Expr4427
• Pattern: Expressed in the rectal epithelial cells from L1 and maintained through adulthood.

• Primary Identifier: Expr4429
• Pattern: Expressed in the hypodermis from embryo stage through adulthood. Expressed in the seam cells from embryo through adult. Expressed in the rectal epithelial cells from L1 and maintained through adulthood. Expressed in anterior and posterior arcades. Expressed in the excretory duct and pore cells.

• Primary Identifier: Expr4218
• Remark: Moreover, neither the dgn-1::GFP promoter reporter nor the rescuing DGN-1::GFP fusion show expression in muscle. Plasmid pJJ516 was made by inserting GFP from pPD114.38 into the HindIII site near the end of the dgn-1 coding sequence. The product contains GFP inserted after residue 575 of DGN-1, with the final seven DGN-1 residues at the C terminus. Expression of DGN-1::GFP is identical to that of the dgn-1::GFP promoter reporter, and DGN-1::GFP rescues the sterility of dgn-1(cg121).
• Pattern: In early (pre-morphological) embryos, dgn-1::GFP expression is evident in many epithelial and neural precursors comprising the outer layer of cells. As elongation begins at comma stage, expression becomes most prominent in several specialized epithelial cells, including pharyngeal e2 and marginal cells, excretory cells, the somatic gonad precursors (SGPs) Z1 and Z4, and rectal epithelial cells. Weaker expression is apparent in hypodermal precursors and neuroblasts along the ventral midline. Pharyngeal expression persists through the L3 larval stage, whereas excretory and rectal cell expression persists throughout development. SGP expression persists in SGP descendants, such as the distal tip cells (DTCs), and increases throughout the gonad during the L4 stage. Variable, generally weak expression is seen throughout larval development in several neurons, although PVP neurons show strong expression throughout development. Transient increased expression occurs in new P cell-derived neurons in the ventral nerve cord in late L1/early L2 stage animals. Variable weak expression is seen in hypodermal cells, principally hyp5 in the head. Preceding the L4/adult molt, expression increases in the vulval epithelium.

• Primary Identifier: Expr4464
• Pattern: Expressed in the rectal epithelial cells from L1 and maintained through adulthood. Expressed in socket cells of IL or OLQ.

• Primary Identifier: Expr4456
• Pattern: Expressed in the hypodermis from embryo stage through adulthood. Expressed in the rectal epithelial cells from L1 and maintain through adulthood. Expressed in the terminal bulb of the pharynx. Expressed in socket cells of IL or OLQ.

• Primary Identifier: Expr4450
• Pattern: Expressed in the seam cells from embryo to L1. Expressed in the rectal epithelial cells from L1 and maintain through adulthood. Expressed in VulA and VulB.

• Primary Identifier: Expr4448
• Pattern: Expressed in the rectal epithelial cells from L1 and maintained through adulthood. Expressed in socket cells of IL or OLQ.

• Primary Identifier: Expr4443
• Pattern: Expressed in the hypodermis in larval and adult stages. Expressed in the seam cells from L1 through adult. Expressed in the rectal epithelial cells from L1 and maintain through adulthood. Expressed in VulA and VulB. Expressed in anterior arcade cells.

• Primary Identifier: Expr4444
• Pattern: Expressed in the hypodermis, mainly in the embryo. Expressed in the rectal epithelial cells only in the first larval stage (L1).

• Primary Identifier: Expr4502
• Pattern: A transcriptional reporter for sel-2 in which the 5' upstream region drives nuclearly localized YFP is expressed in the VPCs and their descendants, as well as in many other cell types, including the epithelial cells of the intestine and the rectum, the seam cells, many cells in the head and the tail, and the cells of the ventral nerve cord.

• Primary Identifier: Expr4503
• Subcellular Localization: In live worms, expression of a rescuing SEL-2::GFP translational reporter was strongest in the rectal epithelial cells and in the seam cells, where it appeared to be distributed throughout the cytoplasm, but particularly concentrated close to the nucleus.

• Primary Identifier: Expr5292
• Remark: Also expressed in (comments from author) : Neural in tail are the PHASMID GLIA i.e. socket cells (Hall Lab, 2005). Strain: BC13998
• Reporter Gene: [C17H11.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATTAAAAATGTTTGCGCCG] 3' and primer B 5' [CGTCGCTGTATGACCAACC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; Reproductive System; uterus; vulva other; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5287
• Remark: Strain: BC13462
• Reporter Gene: [nas-37::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAATATTGTAGGAGGCAAGTCG] 3' and primer B 5' [TGCAAAATAGAACATCAAGAATCG] 3'.
• Pattern: Adult Expression: rectal epithelium; Reproductive System; vulva other; seam cells; Larval Expression: rectal epithelium; hypodermis; seam cells

• Primary Identifier: Expr5279
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14128
• Reporter Gene: [C16C10.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGCCATATTGGTAGCTGTGG] 3' and primer B 5' [GACCGTTGCTGATTTTTCTGA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; rectal epithelium; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: pharynx; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons

• Primary Identifier: Expr5268
• Remark: Also expressed in (comments from author) : Unidentified in head might be amphid socket cells?Embryo incomplete. To be updated. Strain: BC10468
• Reporter Gene: [C15C7.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATTTCAAAATTTCGCCTGAAAA] 3' and primer B 5' [TCGGTAGTTGCTGATTTTCACTAT] 3'.
• Pattern: Adult Expression: intestine; anal sphincter; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head; Larval Expression: intestine; anal sphincter; rectal epithelium; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head

• Primary Identifier: Expr5269
• Remark: Also expressed in (comments from author) : Pharyngeal neuron is probably I3 (Hall Lab, 2005). Strain: BC11857
• Reporter Gene: [klp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAACGAATGACCCACTTCTC] 3' and primer B 5' [CTTTTTCCTTGAAGATTTCCAACT] 3'.
• Pattern: Adult Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head; Larval Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head

• Primary Identifier: Expr5259
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15499
• Reporter Gene: [C13F10.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGTCCATTCCCTTGATAACTTGT] 3' and primer B 5' [TCGCGATCTGTAATTGTAGTGAAT] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; vulval muscle; spermatheca; hypodermis; seam cells; Nervous System; head neurons; Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; developing spermatheca; hypodermis; seam cells; Nervous System; head neurons

• Primary Identifier: Expr5234
• Remark: Strain: BC14107
• Reporter Gene: [C10G8.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTTAATTCTCCAGAATCGCAACT] 3' and primer B 5' [TATCGAGCCCTACGGAATTTTA] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; uterine muscle; vulval muscle; body wall muscle; hypodermis; excretory cell; unidentified cells in tail ; Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; unidentified cells in tail

• Primary Identifier: Expr5150
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14951
• Reporter Gene: [dis-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTAACATAAGCATCCGGGATTTAT] 3' and primer B 5' [ACGTTCAAATCGATACCTTCAAA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; rectal epithelium; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; Larval Expression: pharynx; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; Nervous System; nerve ring; head neurons

• Primary Identifier: Expr5135
• Remark: Strain: BC15653
• Reporter Gene: [C03G6.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTTTGATCTGGAACCAAAAGTG] 3' and primer B 5' [TTGGAGATCTAGAACAAATCAAGT] 3'.
• Pattern: Adult Expression: intestine; rectal epithelium; Reproductive System; vulva other; seam cells; unidentified cells in head; Larval Expression: intestine; rectal epithelium; Reproductive System; developing vulva; seam cells; unidentified cells in head

• Primary Identifier: Expr5103
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15179
• Reporter Gene: [nhr-17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCCTTTCTCTAACTCTTTCGTC] 3' and primer B 5' [TGAAATGAAATAATGAATTGGAGT] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; rectal epithelium; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; rectal gland cells; rectal epithelium; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5485
• Remark: Strain: BC15358
• Reporter Gene: [rpl-34::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCGATGAGACATTTCCGA] 3' and primer B 5' [TAACGCGGAGGGAGATTTTT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterus; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5457
• Remark: Strain: BC15745
• Reporter Gene: [C37C3.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTCTTTCAAAAAGCTACCCA] 3' and primer B 5' [TGATCACCTGATAGGAAAACCA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal epithelium; Nervous System; nerve ring; ventral nerve cord; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal epithelium; Nervous System; nerve ring; ventral nerve cord; tail neurons

• Primary Identifier: Expr5524
• Remark: Also expressed in (comments from author) : very low intensity GFP. Strain: BC12898
• Reporter Gene: [eif-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCAGTGCGAATCTCGTC] 3' and primer B 5' [TCAACCGGGAAACTGGAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal epithelium; Reproductive System; vulva other; spermatheca uterine valve; spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells; Larval Expression: pharynx; intestine; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells

• Primary Identifier: Expr5513
• Remark: Strain: BC14317
• Reporter Gene: [C46C11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGCAGTGTTTGCGGAAGG] 3' and primer B 5' [CGTTTCGGGATTGTTTCAGT] 3'.
• Pattern: Adult Expression: pharynx; arcade cells; rectal epithelium; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; arcade cells; intestine; rectal epithelium; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail

0 Life Stages

2 Parents

Definition	Name	Synonym	Primary Identifier
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
The passageway in the hindgut between the posterior intestine, the rectal valve and the opening to the exterior.	rectum		WBbt:0005773