WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; body wall muscle; Nervous System; neurons along body; unidentified cells in head; Larval Expression: pharynx; body wall muscle; Nervous System; neurons along body; unidentified cells in head; Primary Identifier  Expr5172
Remark  Also expressed in (comments from author) : unidentified cells in head, possibly neuralEmbryo incomplete. To be updated. Strain: BC12925 Reporter Gene  [let-756::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTACCCATTCCTTCTCGGTTT] 3' and primer B 5' [CAGGAACGGCGATATATTCA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

5 Anatomy Terms

Definition Name Synonym Primary Identifier
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses. neuron neurone WBbt:0003679
anterior-most body region containing the pharynx. head   WBbt:0005739

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00002881 let-756 C05D11.4 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023