WormMine: ExpressionPattern Expr5506

• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; Larval Expression: pharynx; pharyngeal-intestinal valve
• Primary Identifier: Expr5506
• Remark: Strain: BC13817
• Reporter Gene: [tag-66::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTTTCAAATGTTTCCGAGAGTG] 3' and primer B 5' [AAGTTTAAACAATCAACCAAACGA] 3'.

2 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine.	pharyngeal-intestinal valve	cardia	WBbt:0005767
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00006443	pak-2	C45B11.1	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023