WormMine: AnatomyTerm WBbt:0005767

• Definition: A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine.
• Name: pharyngeal-intestinal valve
• Primary Identifier: WBbt:0005767
• Synonym: cardia

1 Children

Definition	Name	Synonym	Primary Identifier
cell that makes up the pharyngeal-intestinal valve.	pharyngeal-intestinal valve cell		WBbt:0007848

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Top 300 transcripts enriched in pharyngeal-intestinal valve according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:Pharyngeal_intestinal_valve
	Single-cell RNA-Seq cell group 30_4 expressed in valve.	scVI 0.6.0	WBPaper00065841:30_4

211 Expression Patterns

• Primary Identifier: Expr4898
• Remark: Picture: Figure S2.
• Pattern: SRP-6::GFP was expressed in the socket cells, the pharyngeal-intestinal valve, vulval hypoderm, the spermatheca and spermathecal-uterine junction and the intestine. Corresponding expression was seen in the srp-6::lacZ fusions.

• Primary Identifier: Expr4863
• Pattern: A-class motor neuron: enriched in embryo (3.0) and larva (2.8). Neuronal expression include: Bright in anterior ventral cord neurons, weak and mosaic in posterior ventral cord. Also expressed in other cells: Pharyngeal/intestinal valves, hypodermis. Pan-neuronal: expressed in embryo; enriched in larva (1.8).

• Primary Identifier: Expr4784
• Pattern: Three independent transgenic lines display GFP fluorescence exclusively in VB motor neurons in the ventral nerve cord. ceh-12::GFP, is expressed in all 11 VB motor neurons and in a single head neuron, RID; occasional weak GFP expression was observed in the pharyngeal/intestinal valve cell and in the excretory gland cell.

• Primary Identifier: Expr4985
• Remark: Picture: Fig 5.
• Pattern: GFP expression was specifically localized to a few cells at the anterior and posterior regions of the worm. At the anterior region, the GFP expression was identified in two amphid neurons (ASG), the pharyngeal intestinal (PI) valve (six cells), one to two neurons in retrovesicular ganglion (RVG), and two neurons posterior to the PI valve. The GFP expression in the posterior region was localized to the two phasmid neurons (PHA, PHB) and the anal valve (four cells). The results indicated that the promoter of CEFT-1 is specifically activated in chemosensory neurons (amphids and phasmid neurons) and valve regions (PI valve and anal valve). Promoter expression was evident through all developmental stages with a highly restricted GFP expression.

• Primary Identifier: Expr4594
• Pattern: Analysis of a reporter transgene revealed that act-5 expression is restricted to a small subset of cells within the C. elegans alimentary tract and excretory systems. GFP fluorescence was easily detected within a subset of embryonic, larval, and adult cells in transgenic animals, consistent with previous findings on the act-5 expression pattern. Within larvae and adults, GFP expression occurred within the 20 cells that comprise the adult intestine, and in two sets of three associated cells: one just anterior and one posterior to the intestine. The anterior set corresponds to the middle of three sets of pharyngeal-intestinal valve cells (vpi2), whereas the posterior group of associated cells comprises the rectal epithelial cell (rectD, rect_VL, rect_VR). Finally, the single excretory canal cell, which extends processes along the entire length of the worm, also showed GFP expression.

• Primary Identifier: Expr5291
• Remark: Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. Strain: BC10173
• Reporter Gene: [C17G10.9a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGAAGATATGCCTTCTAGG] 3' and primer B 5' [CGCGTCGAGAGATTACTGAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5292
• Remark: Also expressed in (comments from author) : Neural in tail are the PHASMID GLIA i.e. socket cells (Hall Lab, 2005). Strain: BC13998
• Reporter Gene: [C17H11.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATTAAAAATGTTTGCGCCG] 3' and primer B 5' [CGTCGCTGTATGACCAACC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; Reproductive System; uterus; vulva other; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5277
• Remark: Strain: BC15643
• Reporter Gene: [tag-73::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGTTATCGCTTTCAATTTGACT] 3' and primer B 5' [GCGAGCTGTGATTTCTGGA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal sphincter; Reproductive System; vulval muscle; seam cells; Nervous System; head neurons; amphids; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal sphincter; seam cells; Nervous System; head neurons; amphids

• Primary Identifier: Expr5271
• Remark: Strain: BC10466
• Reporter Gene: [nnt-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCCCCTCATTGATTGTGATCT] 3' and primer B 5' [CGAAGAATGACGATGCTGAA] 3'.
• Pattern: Adult Expression: pharyngeal-intestinal valve; intestine; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharyngeal-intestinal valve; intestine; hypodermis; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5253
• Remark: Strain: BC10460
• Reporter Gene: [C13C4.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAACAAAGTGTGGAAAAGGGA] 3' and primer B 5' [TTTGTTTCTCACGATCGTTCAC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; Reproductive System; vulval muscle; hypodermis; excretory cell; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; hypodermis; excretory cell

• Primary Identifier: Expr5254
• Remark: Strain: BC12278
• Reporter Gene: [C13C4.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAACAAAGTGTGGAAAAGGGA] 3' and primer B 5' [TTTGTTTCTCACGATCGTTCAC] 3'.
• Pattern: Adult Expression: pharyngeal-intestinal valve; intestine; Reproductive System; vulval muscle; hypodermis; Nervous System; head neurons; tail neurons; Larval Expression: pharyngeal-intestinal valve; intestine; hypodermis; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr5220
• Remark: Also expressed in (comments from author) : First observations noted that head and tail neurons expressed. Second observations a year later did not see neural expression. Strain: BC10427
• Reporter Gene: [C09F5.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGCAGCGTTTTCAACTGAT] 3' and primer B 5' [CGTGTGAACGAGGGATCTG] 3'.
• Pattern: Adult Expression: intestine; Nervous System; head neurons; tail neurons; Larval Expression: pharyngeal-intestinal valve; intestine; body wall muscle; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr5208
• Remark: Strain: BC12550
• Reporter Gene: [C08C3.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTTTAAACGACCTGAAAGGAT] 3' and primer B 5' [GCGACGATTTTGAAGAGTTTG] 3'.
• Pattern: Adult Expression: pharynx; arcade cells; Larval Expression: pharynx; arcade cells; pharyngeal-intestinal valve; intestine; rectal gland cells

• Primary Identifier: Expr5203
• Remark: Also expressed in (comments from author) : Pharynx expression is the MARGINAL CELLS (Hall Lab, 2005).unidentified cells in tail and head head is possibly neural, low intensity GFP. Strain: BC12754
• Reporter Gene: [C07H6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTGGAATTGAGTTGGCACTCT] 3' and primer B 5' [GTTGGTGTCGATCAGGTGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; Reproductive System; uterus; uterine-seam cell; vulva other; spermatheca; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; uterine-seam cell; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5177
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15051
• Reporter Gene: [ife-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTACAGCTAATTGCGAAGAATGAA] 3' and primer B 5' [ACGTTTCAGCTTCGATCTCTG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; developing spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5153
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC13956
• Reporter Gene: [pld-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCTTGCGTCCTTACGATCC] 3' and primer B 5' [TGAATGGTCAAAATCAGACC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; Reproductive System; uterus; body wall muscle; Nervous System; head neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; body wall muscle; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5457
• Remark: Strain: BC15745
• Reporter Gene: [C37C3.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTCTTTCAAAAAGCTACCCA] 3' and primer B 5' [TGATCACCTGATAGGAAAACCA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; rectal epithelium; Nervous System; nerve ring; ventral nerve cord; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal epithelium; Nervous System; nerve ring; ventral nerve cord; tail neurons

• Primary Identifier: Expr5432
• Remark: Strain: BC14969
• Reporter Gene: [vav-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATTGCCTCTCACTTCATACTCT] 3' and primer B 5' [GGCACCTGAAAATGCATTAAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; hypodermis; excretory cell; Nervous System; nerve ring; head neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; hypodermis; excretory cell; Nervous System; nerve ring; head neurons

• Primary Identifier: Expr5423
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15498
• Reporter Gene: [C34F11.3b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCATTTCACGCCTCACTCAG] 3' and primer B 5' [GTGTCTTCGGGATTCTTCCTATAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5505
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14946
• Reporter Gene: [tag-66::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTTTCAAATGTTTCCGAGAGTG] 3' and primer B 5' [AAGTTTAAACAATCAACCAAACGA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; hypodermis; Nervous System; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; hypodermis; Nervous System; tail neurons

• Primary Identifier: Expr5506
• Remark: Strain: BC13817
• Reporter Gene: [tag-66::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTTTCAAATGTTTCCGAGAGTG] 3' and primer B 5' [AAGTTTAAACAATCAACCAAACGA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; Larval Expression: pharynx; pharyngeal-intestinal valve

• Primary Identifier: Expr5379
• Remark: Strain: BC13546
• Reporter Gene: [pat-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAATTTACAGATCTTTTGGGCAC] 3' and primer B 5' [CGACAAAGAGATTGTTGACTGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; Reproductive System; vulval muscle; body wall muscle; Nervous System; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; body wall muscle; Nervous System; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5333
• Remark: Strain: BC15292
• Reporter Gene: [C25A1.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTGTTCCACTCATCTCTTCG] 3' and primer B 5' [TATCCCGATATTTTCCACTGAAAT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca uterine valve; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons

• Primary Identifier: Expr5304
• Remark: Also expressed in (comments from author) : early embryo is only gut. Strain: DM12525
• Reporter Gene: [rsp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATCTGTTCCTCCGTTCAA] 3' and primer B 5' [GAACGATGGCCGATTTTG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterus; vulva other; gonad sheath cells; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; tail neurons; unidentified cells in head; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing uterus; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; unidentified cells in head

• Primary Identifier: Expr5080
• Remark: Strain: BC10374
• Reporter Gene: [eif-3.E::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGACATTTTCACGTTTCACGA] 3' and primer B 5' [AAACTCCAATCAATTTTCTTAACG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; rectal epithelium; Reproductive System; vulva other; spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5076
• Remark: Strain: BC15735
• Reporter Gene: [spk-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAGAAGTTGGTGACGAGTCTTG] 3' and primer B 5' [TCCGCCGATATTCTACACTTAAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; Reproductive System; vulva other; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5079
• Remark: Strain: BC10431
• Reporter Gene: [B0496.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTCAAAGATCGGTTATCTTTTGT] 3' and primer B 5' [GTGACGTCGGTGATTACTGAAA] 3'.
• Pattern: Adult Expression: pharyngeal-intestinal valve; intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: pharyngeal-intestinal valve; intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5099
• Remark: Also expressed in (comments from author) : quite a number of processes in head Strain: BC10874
• Reporter Gene: [erm-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAATTTGTTTTGTTTCAGCGTTTC] 3' and primer B 5' [TAGCTCTTTTTGATGTCCGAGTC] 3'.
• Pattern: Adult Expression: pharyngeal-intestinal valve; rectal gland cells; anal sphincter; excretory cell; Nervous System; head neurons; neurons along body; Larval Expression: pharyngeal-intestinal valve; rectal gland cells; anal sphincter; Reproductive System; developing uterus; developing spermatheca; excretory cell; Nervous System; head neurons; neurons along body; unidentified cells

• Primary Identifier: Expr7116
• Remark: Also expressed in (comments from author) : unidentified cells in L1 head Strain: BC13335
• Reporter Gene: [Y73B6BL.30::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATTTGAAAATTCGCCGTTTT] 3' and primer B 5' [TCGTTGATTTCCGCGATT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; Larval Expression: pharynx; pharyngeal-intestinal valve; unidentified cells in head

• Primary Identifier: Expr7158
• Remark: Strain: BC11353
• Reporter Gene: [ZC328.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAATTTTCGGTATCTGAAGACAA] 3' and primer B 5' [TGTGATTGTCGACGTGGAAG] 3'.
• Pattern: Adult Expression: pharyngeal-intestinal valve; intestine; anal sphincter; unidentified cells in head; Larval Expression: pharyngeal-intestinal valve; intestine; anal sphincter; unidentified cells in head

0 Life Stages

2 Parents

Definition	Name	Synonym	Primary Identifier
	alimentary system		WBbt:0005748
entity of anatomical origin that is either entirely acellular or is a collection of cells and acellular parts.	Anatomy	anatomical structure	WBbt:0005766