WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Nervous System; nerve ring; ventral nerve cord; Larval Expression: Nervous System; nerve ring; ventral nerve cord; Primary Identifier  Expr5366
Remark  Strain: BC13370 Reporter Gene  [apt-10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCTCATTCCTCTCGATCTTTCC] 3' and primer B 5' [GGATTGCTCTCATTGAAGCTG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
neuron with cell body associated with the ventral nerve cord. ventral cord neuron ventral cord motoneuron WBbt:0005300
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes. nerve ring circumpharyngeal nerve ring WBbt:0006749

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00006777 unc-41 C27H6.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023