WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: unidentified cells in tail ; Larval Expression: unidentified cells in tail ; Primary Identifier  Expr5339
Remark  Strain: BC10830 Reporter Gene  [goa-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTCTAGCAGAAGCTGATCGATTT] 3' and primer B 5' [AACCGATGGCGCTAGAGTT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
posterior region, from rectum to the end tail   WBbt:0005741

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001648 goa-1 C26C6.2 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023