WormMine: ExpressionPattern Expr5070

• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; Nervous System; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; stomato-intestinal muscle; Nervous System; ventral nerve cord; head neurons; tail neurons
• Primary Identifier: Expr5070
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC11109
• Reporter Gene: [B0416.5a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGCACGATTTTCCTACAAATAA] 3' and primer B 5' [AGCGCCGATTTTGCTTTT] 3'.

7 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
left intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_L	lineage name: ABplpppppaa	WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_R	lineage name: MSppaapp	WBbt:0003822

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00015181	B0416.5	B0416.5	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023