WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: seam cells; Larval Expression: seam cells; Primary Identifier  Expr5066
Remark  Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10407 Reporter Gene  [dac-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTAGTTGTAGATCCTTCCCTCCA] 3' and primer B 5' [TGAGTTCCTGGATTGCTGC] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000895 dac-1 B0412.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023