WormMine: Gene WBGene00000895

• WormBase Gene ID: WBGene00000895
• Gene Name: dac-1
• Sequence Name: B0412.1
• Brief Description: dac-1 encodes the C. elegans ortholog of Dachshund, a transcriptional regulator first described in Drosophila that is a member of the SKI/SNO/DAC family of proteins; dac-1 is expressed at higher levels in the AFD thermosensory neurons as compared to the AWB olfactory neurons and likely plays a role in thermosensory behavior as on thermal gradients dac-1 mutants fail to suppress cryophilic drive but continue to track isotherms at the cultivation temperature; a DAC-1::GFP fusion protein is nuclear and expressed strongly in the AFD thermosensory neurons, but weakly in the AWC, ASE, and ASK chemosensory neurons; expression is also seen in alae and additional, unidentified tail cells; dac-1 expression in AFD is positively regulated by the TTX-1 OTX-like homeodomain protein.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Involved in thermotaxis. Located in nucleus. Expressed in amphid neurons; cuticular ala; and tail. Is an ortholog of human DACH1 (dachshund family transcription factor 1).
• Biotype: SO:0001217
• Genetic Position: III :-25.7793 ±0.003862
• Length (nt): 5586

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00000895

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:B0412.1a.1	B0412.1a.1	1479	III: 816145-821730
Transcript:B0412.1b.1	B0412.1b.1	1365	III: 817470-821699

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:B0412.1a	B0412.1a	1263	III: 816271-816319
CDS:B0412.1b	B0412.1b	954	III: 818599-818616

5 RNAi Result

• WBRNAi00039031
• WBRNAi00009756
• WBRNAi00006647
• WBRNAi00028128
• WBRNAi00110961

159 Allele

• gk963623
• gk962532
• gk964281
• WBVar01322505
• WBVar01322504
• WBVar01322507
• WBVar02069534
• WBVar02069533
• tm665
• WBVar00031888
• WBVar00031913
• WBVar00032013
• WBVar00032018
• WBVar00032023
• WBVar00032008
• WBVar00031978
• WBVar00031988
• WBVar00031983
• WBVar00031998
• WBVar00031923
• WBVar00031928
• WBVar00031953
• gk165448
• gk165447
• gk165450
• gk165449
• gk165444
• gk165446
• gk165445
• gk165456

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00000895
• Start: 816145
• End: 821730
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_821731..823221
• Length (nt): 1491
• Chromosome Location: III: 821731-823221
• Organism: Caenorhabditis elegans

125 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Single-cell RNA-Seq cell group 0_0 expressed in seam.	scVI 0.6.0	WBPaper00065841:0_0
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_downregulated
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in animals with germline-specific inx-14(RNAi) comparing to in aniamls fed with control vector, both exposed to PA14 infection.	DESeq2. Differentially-expressed genes (DEG) were identified based on two criteria: FDR (False discovery rateusing Benjamini-Hochberg adjusted p-values) < 0.01 and absolute value of log2(Fold Change) > 1.	WBPaper00066146:germline-inx-14(RNAi)_upregulated_PA14
	Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult.	The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak.	WBPaper00044736:oscillating_dev_expression
	Transcripts that showed significantly increased expression among animals treated with 400mM sucrose and 500 mg per ml stearic acid from L1 to L4 larva stage comparing to animals grown up on control plates.	CuffDiff, FDR <= 0.05, fold change >= 2.	WBPaper00059253:sucrose_stearic-acid_upregulated
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain.	RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis.	WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in npr-15(tm12539) comparing to in N2 at L4 larva stage.	Fold change > 2, FDR < 0.05.	WBPaper00066608:npr-15(tm12539)_upregulated
	Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:eat-2(ad1116)_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated

9 Expression Patterns

• Primary Identifier: Expr5066
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10407
• Reporter Gene: [dac-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTAGTTGTAGATCCTTCCCTCCA] 3' and primer B 5' [TGAGTTCCTGGATTGCTGC] 3'.
• Pattern: Adult Expression: seam cells; Larval Expression: seam cells

• Primary Identifier: Expr7403
• Remark: Clone: pUL#JRH10C5
• Pattern: Expression post hatching only, in seam cells.

• Primary Identifier: Expr3130
• Pattern: A GFP-tagged DAC-1 fusion protein is expressed strongly in the AFD and weakly in the AWC, ASE, and ASK chemosensory neurons in the head and is nuclear localized. Expression was also observed in the alae, which arise from fusion of the hypodermal seam cells as well as additional unidentified cells in the tail.
• Subcellular Localization: Expressed in nuclei.

• Primary Identifier: Expr2010758
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2028995
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1015167
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1143193
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram2070
• Remark: Original chronogram file: chronogram.977.xml
• Reporter Gene: [B0412.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1200045
• Pattern: Data from the TransgeneOme project

9 GO Annotation

9 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00000895
• Start: 816145
• End: 821730
• Strand: 1

9 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5586

1 Sequence Ontology Term

• Name: gene

5 Strains

• WBStrain00035733
• WBStrain00035736
• WBStrain00035649
• WBStrain00001324
• WBStrain00001325

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIII_813774..816144
• Length (nt): 2371
• Chromosome Location: III: 813774-816144
• Organism: Caenorhabditis elegans