WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: body wall muscle; Larval Expression: body wall muscle; Primary Identifier  Expr5048
Remark  Strain: DM13583 Reporter Gene  [hlh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGTGGTGAGACCCAACAT] 3' and primer B 5' [GTTTCCGTGTTGATTTCTGGA] 3'.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001948 hlh-1 B0304.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023