WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharyngeal gland cells; Larval Expression: pharyngeal gland cells; Primary Identifier  Expr5036
Remark  Also expressed in (comments from author) : pharynx: nice dorsal g1 and ventral g1, g2 gland cells. Strain: BC12917 Reporter Gene  [B0280.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCATAAGTATAATTTCATTCCCA] 3' and primer B 5' [CCAAGGTTTTTGATAATATGATGT] 3'.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
Secretory gland cell of the pharynx Pharyngeal gland cell   WBbt:0005788

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00015103 B0280.7 B0280.7 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023