WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: body wall muscle; Nervous System; head neurons; tail neurons; Larval Expression: body wall muscle; Nervous System; head neurons; tail neurons; Primary Identifier  Expr5710
Remark  Also expressed in (comments from author) : No comments. Strain: BC16021 Reporter Gene  [str-111::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAAAACCTGATTAAGTCACAAA] 3' and primer B 5' [AGGAGCAGATTTCTGGAAACA] 3'.

4 Anatomy Terms

Definition Name Synonym Primary Identifier
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00006162 str-111 F10A3.15 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023