WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharyngeal gland cells; Larval Expression: pharyngeal gland cells; Primary Identifier  Expr5631
Remark  Strain: BC14532 Reporter Gene  [D2085.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATGCGTATCGGACACCAC] 3' and primer B 5' [CGTTTTCCATTTTGAGCCAT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
Secretory gland cell of the pharynx Pharyngeal gland cell   WBbt:0005788

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00008430 hgap-2 D2085.5 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023