WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: stomato-intestinal muscle; anal depressor muscle; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Primary Identifier  Expr5957
Remark  Also expressed in (comments from author) : No comments. Strain: BC16124 Reporter Gene  [F35G12.4a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATCTCTCGGAAGAGCAGGTT] 3' and primer B 5' [GATTTTATTGCATTGAACGCCT] 3'.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents. anal depressor muscle dilator muscle WBbt:0004292
left intestinal muscle cell, attach to intestine and body wall anterior to anus mu_int_L lineage name: ABplpppppaa WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus mu_int_R lineage name: MSppaapp WBbt:0003822

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00009441 wdr-48 F35G12.4 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023