Also expressed in (comments from author) : Mosaic population. Strain: BC10008
Reporter Gene
[tag-167::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTGGTTTCTCGTGGACAT] 3' and primer B 5' [ttcggcgagtctgaatacaa] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.
External Links
No external links.
3 Anatomy Terms
Definition
Name
Synonym
Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization.
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.