WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; rectal epithelium; excretory cell; Larval Expression: pharynx; rectal epithelium; excretory cell; Primary Identifier  Expr6568
Remark  Also expressed in (comments from author) : No comments. Strain: BC14968 Reporter Gene  [gon-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGGTGGAATTAGTCAGTGTTCA] 3' and primer B 5' [CGTCGCTCATCATTTTCGT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812
epithelium connecting intestine and anus. rectal epithelium   WBbt:0005800

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001651 gon-2 T01H8.5 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023