Adult Expression: pharynx; excretory cell; Nervous System; head neurons; Larval Expression: pharynx; excretory cell; Nervous System; head neurons;
Primary Identifier
Expr6560
Remark
Strain: BC10616
Reporter Gene
[T01C8.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATCGACATTCGAGAGGATTTAC] 3' and primer B 5' [GAAAAGATTTCTGAAAATAGTCGG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.
External Links
No external links.
4 Anatomy Terms
Definition
Name
Synonym
Primary Identifier
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.
