WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Hide

Oops!

http://intermine.wormbase.org/tools/wormmine/service/ is incorrect

Expression Pattern :

Pattern  Adult Expression: pharynx; excretory cell; Nervous System; head neurons; Larval Expression: pharynx; excretory cell; Nervous System; head neurons; Primary Identifier  Expr6560
Remark  Strain: BC10616 Reporter Gene  [T01C8.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATCGACATTCGAGAGGATTTAC] 3' and primer B 5' [GAAAAGATTTCTGAAAATAGTCGG] 3'.

4 Anatomy Terms

Definition Name Synonym Primary Identifier
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00020142 aak-2 T01C8.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023