WormMine: ExpressionPattern Expr7037

• Pattern: Adult Expression: excretory cell; Nervous System; head neurons; pharyngeal neurons; unidentified cells in tail ; Larval Expression: excretory cell; Nervous System; head neurons; pharyngeal neurons; unidentified cells in tail
• Primary Identifier: Expr7037
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14906
• Reporter Gene: [ral-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGAAAATTTGCTGAAAATCTACTT] 3' and primer B 5' [AAATTCGAGTTTTAGGGGGAAA] 3'.

5 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
H-shaped cell associated with the excretory system, largest cell in C. elegans.	excretory cell	excretory canal cell	WBbt:0005812
neuron of the pharyngeal nervous system.	pharyngeal neuron		WBbt:0005439
posterior region, from rectum to the end	tail		WBbt:0005741

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00021811	ral-1	Y53G8AR.3	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023