WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: coelomocytes; Larval Expression: coelomocytes; Primary Identifier  Expr6413
Remark  Also expressed in (comments from author) : No comments. Strain: BC15308 Reporter Gene  [M03C11.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCTCGATGCTTCCTGAGTA] 3' and primer B 5' [CCCAAAACGGATAAATTGATTG] 3'.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
A free-floating spherical cell lying in the pseudocoelomic cavity of larvae and adult C. elegans which can endocytose many compounds, possibly for immune surveillance. There are six coelomocytes in adult hermaphrodites, and they display prominent cytoplasmic inclusions and vacuoles. coelomocyte   WBbt:0005751

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00044069 hat-1 M03C11.4 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023