WormMine: AnatomyTerm WBbt:0005751

• Definition: A free-floating spherical cell lying in the pseudocoelomic cavity of larvae and adult C. elegans which can endocytose many compounds, possibly for immune surveillance. There are six coelomocytes in adult hermaphrodites, and they display prominent cytoplasmic inclusions and vacuoles.
• Name: coelomocyte
• Primary Identifier: WBbt:0005751

7 Children

Definition	Name	Synonym	Primary Identifier
Postembryonic coelomocyte in hermaphrodite	ccDL	lineage name: M.dlpa	WBbt:0004564
Postembryonic coelomocyte in hermaphrodite	ccDR	lineage name: M.drpa	WBbt:0004563
Embryonic coelomocytes	ccAL	lineage name: MSapapaaa	WBbt:0004561
Embryonic coelomocytes	ccPL	lineage name: MSapapaap	WBbt:0004559
Embryonic coelomocytes	ccAR	lineage name: MSppapaaa	WBbt:0004560
Embryonic coelomocytes	ccPR	lineage name: MSppapaap	WBbt:0004558
Single male postembryonic coelomocyte	ccD	lineage name: M.dlpappp	WBbt:0004562

13 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L1-larva_expressed
	Top 300 transcripts enriched in coelomocyte according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:Coelomocyte
	Single-cell RNA-Seq cell group 110_0 expressed in coelomocyte.	scVI 0.6.0	WBPaper00065841:110_0
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_embryo_enriched
	Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_embryo_SelectivelyEnriched
	Single-cell RNA-Seq cell group 12_0 expressed in various.	scVI 0.6.0	WBPaper00065841:12_0
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at both embryonic and larval stages.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_CoreEnriched
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_larva_enriched
	Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_larva_SelectivelyEnriched
	Single-cell RNA-Seq cell group 31 expressed in: Coelomocytes.	CellRanger, DecontX, Monocle3, Louvain algorithm.	WBPaper00065623:31
	Micro RNAs that showed significantly decreased expression in day 8 adults comparing to in day 1 adults in coelomocyte.	Differentially expressed miRNAs were identified using DEGseq based on unique molecular identifier (UMI). A minimum UMI sum of 10 in 3 replicates was set as the threshold of expression. MiRNAs with more than five reads were defined as expressed. Differential expression of miRNAs was analysed by t-test (P value < 0.05 and fold-change > 1.5 or < 0.67) after Box-Cox transformation. MiRNA targets were identified by TargetScanWorm (Release 6.2) and Pearson Correlation Coefficient smaller than -0.2.	WBPaper00066447:Day8_vs_Day1_downregulated_coelomocyte
	Micro RNAs that showed significantly increased expression in day 8 adults comparing to in day 1 adults in coelomocyte.	Differentially expressed miRNAs were identified using DEGseq based on unique molecular identifier (UMI). A minimum UMI sum of 10 in 3 replicates was set as the threshold of expression. MiRNAs with more than five reads were defined as expressed. Differential expression of miRNAs was analysed by t-test (P value < 0.05 and fold-change > 1.5 or < 0.67) after Box-Cox transformation. MiRNA targets were identified by TargetScanWorm (Release 6.2) and Pearson Correlation Coefficient smaller than -0.2.	WBPaper00066447:Day8_vs_Day1_upregulated_coelomocyte

243 Expression Patterns

• Primary Identifier: Expr4821
• Remark: Picture: Fig. 10, A and B.
• Pattern: The hex-1 promoter was particularly active in coelomocytes as well as in neurons of the pharyngeal region and nerve cord, as compared with the head and tail pattern observed in strain BC14144 (see Expr6695). Expressed throughout the life-cycle.

• Primary Identifier: Expr4684
• Pattern: GFP expression was detected at most developmental stages, with the spatial expression depending on the developmental stage of the animal. Neuronal expression of hlh-29 was detected in larvae and adults in both amphid and phasmid sockets, in the ALA and PVT neurons, in the chemosensory and mechanosensory neurons, ASI, ASK, PHA, and PQR, and in neurons of the anterior pharyngeal bulb. Weaker expression was also detected in the ASG chemosensory neurons in some transgenic lines. L1 animals show strong expression of hlh-29 in intestinal cells, and weaker expression in the rectal glands and the pharyngeal muscle cell PM1. By L3 stage, intestinal expression of the hlh-29::GFP is limited to the posterior intestinal cells, and PM1 expression is no longer detected. Expression is also detected in the ventral posterior coelomocytes in the later L3-stage larvae, and in the spermatheca and vulval muscles of L4 and adult animals.

• Primary Identifier: Expr4767
• Pattern: Young embryos did not present a GFP signal, but expression was observed in late embryogenesis and at all stages of postnatal development: eggs, L1, L2, L3, L4, and adults. Adult animals showed stronger expression than did larval stages and eggs; this was also proved by RT-polymerase chain reaction (RT-PCR), suggesting potential developmental dynamics in atx-3 function. Both transgenic strains had a generalized expression pattern, with a strong signal in the spermatheca and vulval muscle . High fluorescence was observed in neuronal dorsal and ventral cord and neurons of the head and tail. Expression was also observed in the hypoderm, body muscles, and coelomocytes.

• Primary Identifier: Expr4768
• Pattern: vps-45::EGFP is ubiquitously expressed in all major tissues, such as neuron, muscle, hypodermis and intestine. vps-45::EGFP is also expressed in coelomocytes.

• Primary Identifier: Expr4748
• Pattern: Expressed in coelomocytes.
• Subcellular Localization: BSA-Rhod pulse chase analysis established that this marker normally resides in the limiting membrane of lysosomes, the terminal endocytic compartment in coelomocytes. LMP-1::GFP localizes to the limiting membrane of the large abnormal vacuoles of cup-5 mutant coelomocytes.

• Primary Identifier: Expr4733
• Remark: rrc-1 = yk273h6
• Pattern: GFP expression was detected in the coelomocytes, excretory cell, and uterine-seam cell. GFP signals were also detected in a bilateral pair of cells near posterior isthmus of pharynx. These cells were identified as GLRL and GLRR based on their positions and characteristic morphology. Relatively weak expression was seen in developing embryos.

• Primary Identifier: Expr4403
• Pattern: Strong and consistent expression was observed in a limited number of neurons in the head and tail and coelomocytes. Weaker and/or inconsistent expression of TTX-7::EGFP was detected in nerve cord motor neurons, intestine, and somatic gonad. The head neurons expressing ttx-7::EGFP include AFD and RIA neurons. Also expressed in ASH, ASE, ASJ, AWC, ADF, ADL, ASI, ASK, AWB, VNC motor neurons, etc.
• Subcellular Localization: TTX-7::EGFP was diffusely expressed in the cytoplasm and was not localized to any specific subcellular compartment.

• Primary Identifier: Expr4281
• Reporter Gene: [wrk-1::TM-gfp] translational fusion. wrk-1 expression was determined by means of a reporter construct (wrk1::TM::gfp), in which 4 kb of sequences upstream of the ATG start codon, all exons, and the first three introns of the wrk-1 locus were fused in frame to gfp. This construct is able to rescue the phenotype of wrk-1 mutant animals. See Transgene otEx2389. [wrk-1::gfp] transcriptional fusion in which 4 kb of sequences upstream of the ATG start codon was fused to GFP. See Transgene otEx203 [wrk-1::gfp] translational fusion. See Transgene otEx2522.
• Pattern: The wrk-1 gene is expressed in ventral midline cells, namely in the eMNs. Additional expression is observed in a subset of head neurons, including interneurons (AIY class), sensory neurons (ASI class), and head motoneurons (SMDV/D class), and glial-type sheath and socket cells. Outside the nervous system, the most prominent sites of wrk-1 expression include the intestine, excretory gland cell, distal tip cell, and coelomocytes.

• Primary Identifier: Expr5271
• Remark: Strain: BC10466
• Reporter Gene: [nnt-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCCCCTCATTGATTGTGATCT] 3' and primer B 5' [CGAAGAATGACGATGCTGAA] 3'.
• Pattern: Adult Expression: pharyngeal-intestinal valve; intestine; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharyngeal-intestinal valve; intestine; hypodermis; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5272
• Remark: Also expressed in (comments from author) : Intestinal expression is mosaic. Strain: BC10066
• Reporter Gene: [hsp-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGCAACAAACGAATAATAG] 3' and primer B 5' [tttgtgtttgatttattttcctg] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; intestine; stomato-intestinal muscle; coelomocytes; Nervous System; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; intestine; stomato-intestinal muscle; Nervous System; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5176
• Remark: Also expressed in (comments from author) : GLR head neurons are expressing (Hall Lab, 2005). Strain: BC14109
• Reporter Gene: [snx-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAAAAACTGAAGGTTGGTTGT] 3' and primer B 5' [CTTCCGACAAGATTTCCAGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; arcade cells; intestine; Reproductive System; spermatheca uterine valve; head mesodermal cell; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; arcade cells; intestine; head mesodermal cell; coelomocytes; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5150
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14951
• Reporter Gene: [dis-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTAACATAAGCATCCGGGATTTAT] 3' and primer B 5' [ACGTTCAAATCGATACCTTCAAA] 3'.
• Pattern: Adult Expression: pharynx; anal depressor muscle; rectal epithelium; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; Larval Expression: pharynx; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; Nervous System; nerve ring; head neurons

• Primary Identifier: Expr5485
• Remark: Strain: BC15358
• Reporter Gene: [rpl-34::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCGATGAGACATTTCCGA] 3' and primer B 5' [TAACGCGGAGGGAGATTTTT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterus; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5461
• Remark: Strain: BC15734
• Reporter Gene: [ppn-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATGCACTTTACAGCAAAACC] 3' and primer B 5' [ATGGTGTGACGTCTGTAGTTAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; coelomocytes; Nervous System; head neurons; neurons along body; Larval Expression: stomato-intestinal muscle; anal depressor muscle; body wall muscle; coelomocytes; Nervous System; head neurons; neurons along body

• Primary Identifier: Expr5459
• Remark: Strain: BC11970
• Reporter Gene: [C37C3.6a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATGCACTTTACAGCAAAACC] 3' and primer B 5' [ATGGTGTGACGTCTGTAGTTAGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; coelomocytes; unidentified cells in body ; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; coelomocytes; unidentified cells in body

• Primary Identifier: Expr5381
• Remark: Strain: BC14421
• Reporter Gene: [C29H12.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAATGGAAATTGTCGACTGCT] 3' and primer B 5' [GCCACGATCTTGTCTGAAACTAT] 3'.
• Pattern: Adult Expression: intestine; stomato-intestinal muscle; Reproductive System; vulval muscle; coelomocytes; Nervous System; ventral nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: intestine; stomato-intestinal muscle; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5064
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14242
• Reporter Gene: [B0403.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCGTGAAAATTATCAAAACTTCG] 3' and primer B 5' [AGCCATGACGATCCACTAATCT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; intestine; Reproductive System; uterine-seam cell; excretory gland cells; coelomocytes; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; intestine; excretory gland cells; coelomocytes; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5037
• Remark: Strain: BC15640
• Reporter Gene: [B0284.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGGAAAAAGTGTGCTTAATTTGA] 3' and primer B 5' [TTATTTCGGATGTCTTGAGCAAT] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; coelomocytes; Nervous System; head neurons; Larval Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; developing vulva; gonad sheath cells; body wall muscle; hypodermis; coelomocytes; Nervous System; head neurons

• Primary Identifier: Expr9215
• Pattern: abtm-1::GFP2 showed widespread expression in the tissues of adult hermaphrodites including the intestine, spermatheca, epidermis and coelomocytes, amongst others. Interestingly, abtm-1::GFP2 is highly expressed in tissues that are predicted to require high levels of energy production such as pharyngeal muscles, neurons, developing embryos, and body wall muscles, amongst others. Expression analysis showed that ABTM-1 is a widely expressed mitochondrial protein that it is produced at particularly high levels in tissues which are expected to have high energy requirements.

• Primary Identifier: Expr10800
• Subcellular Localization: NLP-40::YFP fusion protein adopted a highly punctate pattern of fluorescence on the basolateral surface of the intestinal cells. YFP fluorescence was also detected in six coelomocytes.

• Primary Identifier: Expr14545
• Pattern: LIPL-5::tdTOMATO fluorescence was only detected in the six coelomocytes of C. elegans

• Primary Identifier: Expr7749
• Remark: Clone: pUL#JRH7H10
• Pattern: A complex expression pattern. Expression is seen in the somatic gonad, from L1 to adult. Expression in the spermathecae is strong in the adult. Expression in the excretory cell, the coelomocytes, and some nerve cells is prominent. There is also strong, unrestricted expression in mid-stage embryos.

• Primary Identifier: Expr7738
• Remark: Clone: pUL#IAH10E8
• Pattern: Strong expression observed in UL2824. The same pattern but weaker was observed in UL2822. But no expression was observed in the only other line generated. Expression was mainly in 4 amphids and 4 other head nerve cells. Weaker expression also seen in dorsal and ventral nerve cords and tail nerve cells. Expression in lateral nerve cells and coelomocytes can be seen but even more weakly. There is also weak, potentially background, expression in posterior intestine and anterior body wall muscle cells. All of these components were seen from late embryogenesis to adult. In L1s, there is also weak expression in the hypodermis apart from the seam cells.

• Primary Identifier: Expr5679
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14696
• Reporter Gene: [F08C6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGGATCAACTCGAAGCATATTGA] 3' and primer B 5' [CGAGGGATTATTTGTGCTGAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterus; uterine muscle; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing gonad; developing vulva; developing uterus; developing spermatheca; body wall muscle; hypodermis; seam cells; excretory cell; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5736
• Remark: Strain: BC12190
• Reporter Gene: [unc-122::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGTTACATCTCATATACTCTGGGC] 3' and primer B 5' [ATTGTGAGCCCAATGAAGTAAAA] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; coelomocytes; Nervous System; head neurons; pharyngeal neurons; Larval Expression: intestine; rectal gland cells; coelomocytes; Nervous System; head neurons; pharyngeal neurons; unidentified cells in body

• Primary Identifier: Expr5597
• Remark: Also expressed in (comments from author) : No comment. Strain: BC11002
• Reporter Gene: [C56C10.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCAACGTTTTTCTCTATTTGGTGA] 3' and primer B 5' [TGCCGAACAGGCTGATTT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; spermatheca uterine valve; spermatheca; gonad sheath cells; body wall muscle; hypodermis; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; body wall muscle; hypodermis; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons

• Primary Identifier: Expr5612
• Remark: Strain: BC15733
• Reporter Gene: [D1046.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAAATGCCTATCAAATGCGAA] 3' and primer B 5' [CGATCAATCCTCAAACAAACAA] 3'.
• Pattern: Adult Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; rectal epithelium; Reproductive System; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; coelomocytes; Larval Expression: pharynx; intestine; rectal gland cells; anal depressor muscle; rectal epithelium; body wall muscle; hypodermis; coelomocytes

• Primary Identifier: Expr5893
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14985
• Reporter Gene: [F28B4.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGTTGGAATTGGGGGAT] 3' and primer B 5' [GCGTAGCGATTTAAGATTGGTC] 3'.
• Pattern: Adult Expression: rectal epithelium; Reproductive System; vulva other; hypodermis; excretory cell; coelomocytes; Nervous System; head neurons; Larval Expression: rectal epithelium; hypodermis; excretory cell; coelomocytes; Nervous System; head neurons

• Primary Identifier: Expr5997
• Remark: Strain: BC10950
• Reporter Gene: [let-92::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGATTGGTTGAGCAGTCAGA] 3' and primer B 5' [GGGGCAGCAGCGATACTA] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; uterine muscle; vulval muscle; vulva other; body wall muscle; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; neurons along body; tail neurons; phasmids; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; neurons along body; tail neurons; phasmids

• Primary Identifier: Expr5944
• Remark: Also expressed in (comments from author) : Mosaic population.Hypodermis: only in the tail.Coelomocytes: saw the 4 ventral cells. Strain: BC14222
• Reporter Gene: [F33H2.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACATAATCGATAGACTCCCAGC] 3' and primer B 5' [TAGACGGGATGATTGAGGATG] 3'.
• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; excretory gland cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; anal depressor muscle; anal sphincter; rectal epithelium; Reproductive System; distal tip cell; developing gonad; developing vulva; developing uterus; uterine-seam cell; developing spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory gland cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body

0 Life Stages

2 Parents

Definition	Name	Synonym	Primary Identifier
a cellular object that consists of subcellular components, expresses genes or functions.	Cell	Cell type	WBbt:0004017
	coelomic system		WBbt:0005749