WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; hypodermis; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; hypodermis; unidentified cells in head; unidentified cells in tail ; Primary Identifier  Expr6799
Remark  Also expressed in (comments from author) : GFP is low intensity. Strain: BC13250 Reporter Gene  [T27F7.3b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTACCTGTTTTCCACGTGCC] 3' and primer B 5' [TGCGATGGAGATATATCAGTGGT] 3'.

4 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
posterior region, from rectum to the end tail   WBbt:0005741
anterior-most body region containing the pharynx. head   WBbt:0005739

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00020868 eif-1 T27F7.3 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023