WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; spermatheca; seam cells; Larval Expression: seam cells; Primary Identifier  Expr6661
Remark  Strain: BC10477 Reporter Gene  [T10E9.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCCAAAACCTTTCTTTTTCC] 3' and primer B 5' [AAAATTTCGCTGTCGATTTTT] 3'.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization. spermatheca   WBbt:0005319
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00020417 nuo-2 T10E9.7 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023