WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; seam cells; unidentified cells in head; Larval Expression: seam cells; Primary Identifier  Expr6107
Remark  Also expressed in (comments from author) : Notes were not entered into database, and images are only for larval/adult. Have extrapolated data from the images, but this leaves the analysis incomplete.GFP in the head may be arcade cells, hard to tell from image. Strain: BC13765 Reporter Gene  [lin-42::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTAACCGGTCACTCTGTACTCTG] 3' and primer B 5' [CTCGATTTGGCTGATGGTG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753
anterior-most body region containing the pharynx. head   WBbt:0005739

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00018572 lin-42 F47F6.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023