Genomics
7 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:F47F6.1b.1 | F47F6.1b.1 |
2753
 |
II: 1233236-1244035 |
| Transcript:F47F6.1a.1 | F47F6.1a.1 |
2320
|
II: 1233236-1236969 |
| Transcript:F47F6.1g.1 | F47F6.1g.1 |
297
|
II: 1234175-1234625 |
| Transcript:F47F6.1e.1 | F47F6.1e.1 |
1011
|
II: 1234175-1240101 |
| Transcript:F47F6.1d.1 | F47F6.1d.1 |
1965
|
II: 1234175-1252359 |
| Transcript:F47F6.1c.1 | F47F6.1c.1 |
1538
|
II: 1239367-1244035 |
| Transcript:F47F6.1f.1 | F47F6.1f.1 |
1533
|
II: 1239523-1252359 |
Other
7 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:F47F6.1e | F47F6.1e |
1011
|
II: 1234175-1234429 |
| CDS:F47F6.1c | F47F6.1c |
1362
|
II: 1239523-1240223 |
| CDS:F47F6.1f | F47F6.1f |
1533
|
II: 1239523-1240223 |
| CDS:F47F6.1a | F47F6.1a |
894
|
II: 1234175-1234429 |
| CDS:F47F6.1b | F47F6.1b |
1794
|
II: 1234175-1234429 |
| CDS:F47F6.1d | F47F6.1d |
1965
|
II: 1234175-1234429 |
| CDS:F47F6.1g | F47F6.1g |
297
|
II: 1234175-1234429 |
89 RNAi Result
513 Allele
| Public Name |
|---|
| gk964317 |
| gk963801 |
| h4453 |
| h3979 |
| WBVar01603061 |
| WBVar00164496 |
| n1089 |
| WBVar01435852 |
| WBVar01435858 |
| WBVar01435859 |
| WBVar01435856 |
| WBVar01435861 |
| gk133285 |
| gk133286 |
| gk133283 |
| gk133284 |
| gk133281 |
| gk133282 |
| gk133279 |
| gk133280 |
| gk133288 |
| gk133289 |
| gk133287 |
| gk133296 |
| gk133294 |
| gk133295 |
| gk133292 |
| gk133293 |
| gk133290 |
| gk133291 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00018572 | 1233236 | 1252359 | -1 |
3 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrII_1230783..1233235 | 2453 | II: 1230783-1233235 | Caenorhabditis elegans |
245 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. | Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. | WBPaper00045420:fertilization_downregulated_transcript | |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
| Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_NoFood |
| Coexpression clique No. 60, 176662_at-Y53F4B.16, on the genome-wide coexpression clique map for the nematode GPL200 platform. | All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. | WBPaper00061527:176662_at-Y53F4B.16 | |
| Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:arcade_intestinal-valve_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. | edgeR, fold change > 2, FDR < 0.05 | WBPaper00060909:atfs-1(cmh15)_downregulated | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). | For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). | WBPaper00040858:eQTL_age_regulated_developing | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141) | |
| Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141) | |
| Bacteria infection: Bacillus thuringiensis | Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304. | N.A. | WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated |
| Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. | Fold change > 2. | WBPaper00064306:Agaro-oligosaccharides_upregulated | |
| Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
| Transcripts that showed significantly increased expression at the intestine cells of daf-2(e1370) comparing to the intestine cells of N2 animals at L2 larva stage. | DESeq2 (version 1.24.0), fold change >= 2, FDR < 0.05 | WBPaper00064632:daf-2(e1370)_upregulated_intestine | |
| Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. | DESeq2, fold change > 2, adjusted p-value < 0.01 | WBPaper00058598:sin-3(tm1276)_downregulated | |
| Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. | Cufflinks | WBPaper00065120:body-muscle-transcriptome | |
| Transcripts that showed significantly decreased expression in npr-8(ok1439) animals with 24 hour exposure to P. aeruginosa PA14, comparing to N2 animals with 24 hour exposure to P. aeruginosa PA14. | DESeq2, fold change > 1.5, FDR < 0.05. | WBPaper00058948:npr-8(ok1439)_downregulated_PA14 | |
| Gamma irradiation 100 mGY per hour for 72 hours since L1 larva. | Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage. | DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3. | WBPaper00058958:100mGy-irradiation-72h_upregulated |
| Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult. | The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak. | WBPaper00044736:oscillating_dev_expression | |
| Transcripts that showed significantly decreased expression in miR-85(n4117), comparing to in N2 at 20C. | DESeq2 FDR < 0.05 | WBPaper00061800:miR-85(n4117)_downregulated_20C | |
| Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2. | DESeq 2, fold change > 2, FDR < 0.05. | WBPaper00065581:hpk-1(pk1393)_upregulated | |
| Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain. | RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis. | WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR | |
| Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. | DESeq2, fold change > 2, FDR < 0.05. | WBPaper00066594:ilc-17.1(syb5296)_upregulated | |
| Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. | DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. | WBPaper00062159:hda-2(ok1479)_upregulated |
13 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Expr4568 | These antibodies reveal that LIN-42C/D is nuclear and broadly expressed. | |||
| Expr2871 | The mRNAs for lin-42, nhr-23, and nhr-41a exhibit a low-high (peak)-low profile during the L1 intermolt that is precisely reiterated at later stages. The mRNAs for nhr-25a, nhr-25b, and nhr-41b have a high-low-high (peak) expression profile during the L1 stage (and into early L2) that is also reiterated. nhr-25a and nhr-41b also show a downward trend in baseline expression as development proceeds. For all six mRNAs, there are peaks of expression that occur at precise intervals relative to the molt at all larval stages: nhr-25b and nhr-41b peak at the beginning of the intermolt; nhr-23 peaks at mid-intermolt, slightly preceding the intermolt peak in lin-42 expression; and nhr-25a and nhr-41a peak at the time the larval molts occur. Two mRNAs, nhr-6 and nhr-85a, show a more irregular expression pattern with respect to the molt; however, it should be noted that nhr-6 mRNA has consistent relatively lower expression values at the times the molt takes place. nhr-67 also does not display a reiterated, oscillating expression pattern, although two early peaks are observed at the end of the L1 stage and at the beginning of L2. | |||
| Also expressed in (comments from author) : Notes were not entered into database, and images are only for larval/adult. Have extrapolated data from the images, but this leaves the analysis incomplete.GFP in the head may be arcade cells, hard to tell from image. Strain: BC13765 | [lin-42::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTAACCGGTCACTCTGTACTCTG] 3' and primer B 5' [CTCGATTTGGCTGATGGTG] 3'. | Expr6107 | Adult Expression: pharynx; seam cells; unidentified cells in head; Larval Expression: seam cells; | |
| Expr1151511 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| [lin-42ap::gfp-pest] transcriptional fusion. The start codon of lin-42a and 3,043 bps of upstream sequence were fused with gfp-pest. --precise ends. | Expr9861 | GFP expressed from the lin-42a promoter was robustly expressed in the pharyngeal myoepithelium midway through the L1 stage and continuously thereafter. The lin-42a reporter was also expressed in hyp7 and the lateral seam cells of late L1-stage larvae undergoing the first molt. Expression of the lin-42a reporter in the hypodermis was detected later in the L1 stage than expression of the lin-42b reporter. Fluorescence from the lin-42a reporter also persisted through ecdysis, whereas fluorescence from the lin-42b reporter dissipated during lethargus. To fully define the cyclical expression pattern of the lin-42ap::gfp-pest fusion gene, we measured the relative intensity of the associated fluorescence in the hypodermis throughout larval development. The intensity of fluorescence repeatedly increased 2- to 10-fold during the molts and dropped to background levels early in the next life stage. | ||
| This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope). | Expr691 | First detected in late embryonic stage and continues to be detected through to adulthood. Intensity is higher in animals undergoing ecdysis. Subcellular accumulation generally enriched in nuclei relative to cytoplasm. Cytoplasmic signal is enhanced in lateral seam cells during the molt periods. There is a period of cytokinesis where LIN-42::GFP is not observed. L3 molt: Higher intensity in seam cells, but most intense in V1.pppp. Cells that stain at this stage: H1.aa, V4.papp, H1.app, V5.pppp, H2.ppp V6.papp, V2.papp V6.pppp, V2.pppp, V3.papp, V3.pppp, V4.pppp. L4 molt higher intensity of staining observed in the cytoplasm of seam cell. LIN-42::GFP is present in lateral hypodermis, hyp7 synctium which includes main body hypodermis and head and tail hypodermal cells. | Expressed in cytoplasm of seam cell during L4 molt. | |
| Expr2013185 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1037993 | Tiling arrays expression graphs | |||
| Expr1025392 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr12252 | Plin-42a::GFP-pest and Plin- 42b::mCherry-pest reporters displayed highly pulsatile expression during the L1 stage with initiation and termination of expression at 12 and 28 hours post L1 arrest, respectively. In addition, Plin-42a::GFP-pest expression peaks at 16 hrs, immediately preceding the expression of the Pmir::GFPpest reporters, while the peak of Plin-42b::mCherry-pest expression occurs at 20 hrs. Detailed analysis of individual L3-to-adult animals indicates that Plin-42a::GFP-pest expression displays a temporal expression pattern that is highly similar to Plin-4::GFP-pest and Plet-7::GFP-pest expression. Specifically, in all three reporters, GFP-pest expression diminishes prior to L3 ecdysis, resumes prior to the L4 lethargus period, and terminates immediately after L4 ecdysis. | |||
| This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope). | Expr693 | mRNA level is lower in animals undergoing ecdysis compared to levels in intermolt animals. | ||
| This information was extracted from published material (Archana Sharma-Oates, Andrew Mounsey and Ian A. Hope). | Expr692 | lin-42 mRNA levels cycle during each larval stage. mRNA levels peak during intermolt periods approximately 3h before each molt and declines dramatically during ecdysis. After L4 to adult molt mRNA levels remain low. | ||
| Expr2031417 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). |
13 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| enables | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| happens_during(GO:0009408) | involved_in |
| involved_in | |
| involved_in | |
| involved_in |
13 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| enables | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| happens_during(GO:0009408) | involved_in |
| involved_in | |
| involved_in | |
| involved_in |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrII_1252360..1252429 | 70 | II: 1252360-1252429 | Caenorhabditis elegans |
