WormMine: ExpressionPattern Expr6056

• Pattern: Adult Expression: Nervous System; head neurons; Larval Expression: pharyngeal-intestinal valve; Nervous System; head neurons
• Primary Identifier: Expr6056
• Remark: Strain: BC14536
• Reporter Gene: [mpk-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATTTTACGGGTTCTCTCTCATCT] 3' and primer B 5' [GTATCCACGTTGGGATCATGT] 3'.

3 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine.	pharyngeal-intestinal valve	cardia	WBbt:0005767
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00003401	mpk-1	F43C1.2	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023