WormMine: ExpressionPattern Expr6281

• Pattern: Larval Expression: seam cells
• Primary Identifier: Expr6281
• Remark: Also expressed in (comments from author) : no GFP expression after early larval. Strain: BC13132
• Reporter Gene: [H22D14.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATCGATTTCAGGCCAACC] 3' and primer B 5' [GTCTCTCTGCTTCCATTATTTGGT] 3'.

1 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail	seam cell	lateral hypodermis	WBbt:0005753

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00010410	nhr-267	H22D14.1	Caenorhabditis elegans

1 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023